Incidental Mutation 'R7474:Vangl1'
ID579325
Institutional Source Beutler Lab
Gene Symbol Vangl1
Ensembl Gene ENSMUSG00000027860
Gene NameVANGL planar cell polarity 1
SynonymsmStbm, stbm, Lpp2, KITENIN
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R7474 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location102153583-102204693 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102184249 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 174 (F174L)
Ref Sequence ENSEMBL: ENSMUSP00000029453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029453] [ENSMUST00000159388] [ENSMUST00000159586] [ENSMUST00000168312]
Predicted Effect probably benign
Transcript: ENSMUST00000029453
AA Change: F174L

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000029453
Gene: ENSMUSG00000027860
AA Change: F174L

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Strabismus 23 360 3.4e-171 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159388
AA Change: F174L

PolyPhen 2 Score 0.181 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000125043
Gene: ENSMUSG00000027860
AA Change: F174L

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Strabismus 25 526 8.6e-262 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159586
SMART Domains Protein: ENSMUSP00000124874
Gene: ENSMUSG00000027860

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Strabismus 23 137 3.5e-41 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168312
AA Change: F174L

PolyPhen 2 Score 0.519 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126254
Gene: ENSMUSG00000027860
AA Change: F174L

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Strabismus 23 357 1.2e-170 PFAM
Pfam:Strabismus 354 476 9.5e-67 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tretraspanin family. The encoded protein may be involved in mediating intestinal trefoil factor induced wound healing in the intestinal mucosa. Mutations in this gene are associated with neural tube defects. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a gene trapped allele display abnormal orientation of cochlear hair cell stereociliary bundles but do not develop neural tube or cardiac outflow tract abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,328,088 C3089* probably null Het
Abcc1 A G 16: 14,472,986 T1487A possibly damaging Het
Agfg1 T A 1: 82,882,411 L333* probably null Het
Agfg2 C A 5: 137,653,868 V410F possibly damaging Het
Amotl2 T C 9: 102,730,111 V706A probably benign Het
Apob A T 12: 8,009,185 T2556S probably benign Het
Asb18 T A 1: 89,993,033 H174L possibly damaging Het
Atp10a G A 7: 58,658,527 E25K unknown Het
Aup1 T C 6: 83,054,967 L65P probably benign Het
Blvra T C 2: 127,086,849 F86L probably damaging Het
Cabp4 T C 19: 4,139,399 D53G probably benign Het
Cd300c2 T A 11: 114,998,296 E153V probably benign Het
Crxos A G 7: 15,902,931 E143G possibly damaging Het
Csmd2 A G 4: 128,546,127 N3125D Het
Cyp2c67 T A 19: 39,617,432 Q340L probably null Het
Dscam T A 16: 96,819,889 N540Y possibly damaging Het
E2f8 G A 7: 48,875,760 R155W probably damaging Het
Ext1 A T 15: 53,344,489 V292D probably damaging Het
Extl3 T C 14: 65,076,641 E364G possibly damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Fsd1 A T 17: 55,988,149 D46V possibly damaging Het
Gcnt2 T A 13: 40,958,257 L374H probably damaging Het
Gm10309 G A 17: 86,504,667 probably benign Het
Gm13084 T C 4: 143,811,699 D234G probably benign Het
Gm14410 A T 2: 177,202,825 probably null Het
Gm5114 A T 7: 39,407,980 S738R probably benign Het
Gtf3c2 C A 5: 31,167,756 G502W probably damaging Het
Insc G A 7: 114,768,823 probably null Het
Kcnt2 T C 1: 140,570,478 Y898H possibly damaging Het
Kctd19 C A 8: 105,392,032 R299L probably benign Het
Klf10 T C 15: 38,297,202 N198S probably benign Het
L3mbtl1 A T 2: 162,966,604 D574V probably damaging Het
Lamc1 G A 1: 153,332,265 A92V possibly damaging Het
Lrrc63 T A 14: 75,126,203 T163S possibly damaging Het
Mak T A 13: 41,051,480 K127N probably damaging Het
Mdga2 G A 12: 66,486,761 Q945* probably null Het
Mthfr T A 4: 148,052,602 I519N possibly damaging Het
Mtmr2 C A 9: 13,799,225 H357N probably damaging Het
Myh13 A T 11: 67,327,164 E21V possibly damaging Het
Myh13 A C 11: 67,367,711 Q184P Het
Nans T A 4: 46,502,484 L307Q probably damaging Het
Ncan C A 8: 70,102,041 R1042L possibly damaging Het
Nrg3 T C 14: 39,011,999 E310G probably damaging Het
Obsl1 A C 1: 75,498,184 N857K probably benign Het
Olfml2a T C 2: 38,960,261 V663A probably damaging Het
Olfr1104 T C 2: 87,022,554 probably benign Het
Olfr116 T C 17: 37,624,386 D83G probably benign Het
Olfr213 G T 6: 116,541,038 C195F probably damaging Het
Olfr603 A G 7: 103,383,762 I80T probably damaging Het
Olfr621-ps1 C A 7: 103,629,147 W271L unknown Het
Pla2g4a T C 1: 149,865,200 M363V possibly damaging Het
Prickle1 A T 15: 93,508,671 V157D possibly damaging Het
Pstk A G 7: 131,373,633 N105S probably benign Het
Ptpn21 A G 12: 98,737,363 probably null Het
Rnf2 T A 1: 151,471,716 E277D probably benign Het
Rnpepl1 T C 1: 92,918,972 F532S probably benign Het
Rtn1 C T 12: 72,308,390 A261T possibly damaging Het
Ryr2 A G 13: 11,594,876 S4355P probably benign Het
Sacs T G 14: 61,211,178 L3558V probably benign Het
Senp6 T C 9: 80,142,328 V1047A probably damaging Het
Slco2b1 A T 7: 99,664,832 C515S probably damaging Het
Smgc T A 15: 91,860,694 V732E possibly damaging Het
Sorcs1 T C 19: 50,153,112 M1105V possibly damaging Het
Spats1 A G 17: 45,457,161 Y160H possibly damaging Het
Tnfsf14 T A 17: 57,190,848 D128V Het
Tns3 T C 11: 8,530,894 Q234R probably damaging Het
Uxs1 A G 1: 43,757,024 V306A possibly damaging Het
Vac14 T A 8: 110,636,434 V304D probably damaging Het
Vav1 A G 17: 57,299,102 E242G probably benign Het
Vsir A G 10: 60,368,922 N305D probably benign Het
Vwce T A 19: 10,646,941 C399S possibly damaging Het
Wrn A T 8: 33,329,181 L248M probably damaging Het
Zfp141 T A 7: 42,476,254 K265* probably null Het
Zfp735 A T 11: 73,711,176 K315N possibly damaging Het
Other mutations in Vangl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00640:Vangl1 APN 3 102158229 utr 3 prime probably benign
IGL00870:Vangl1 APN 3 102189440 missense probably damaging 1.00
IGL01533:Vangl1 APN 3 102163351 missense possibly damaging 0.88
IGL01981:Vangl1 APN 3 102184291 missense probably damaging 1.00
IGL02792:Vangl1 APN 3 102163423 missense probably damaging 0.98
IGL02800:Vangl1 APN 3 102163295 splice site probably benign
IGL02942:Vangl1 APN 3 102184031 missense probably damaging 1.00
IGL03029:Vangl1 APN 3 102184084 missense probably damaging 1.00
R0600:Vangl1 UTSW 3 102166937 missense probably damaging 1.00
R0904:Vangl1 UTSW 3 102183994 missense probably damaging 0.99
R1230:Vangl1 UTSW 3 102158293 missense probably benign 0.00
R1829:Vangl1 UTSW 3 102163466 missense probably benign
R2005:Vangl1 UTSW 3 102163466 missense probably benign
R2268:Vangl1 UTSW 3 102196844 missense probably damaging 1.00
R4181:Vangl1 UTSW 3 102165781 intron probably benign
R4662:Vangl1 UTSW 3 102166922 missense probably benign 0.00
R4724:Vangl1 UTSW 3 102184554 missense probably damaging 1.00
R4755:Vangl1 UTSW 3 102158292 missense probably benign 0.19
R5548:Vangl1 UTSW 3 102184446 missense possibly damaging 0.76
R5740:Vangl1 UTSW 3 102184134 missense probably damaging 0.99
R5758:Vangl1 UTSW 3 102184092 missense probably damaging 1.00
R6150:Vangl1 UTSW 3 102184519 missense probably damaging 1.00
R6373:Vangl1 UTSW 3 102158448 missense probably benign
R6943:Vangl1 UTSW 3 102165781 intron probably benign
R7616:Vangl1 UTSW 3 102184065 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACAAGAGAGACTGCGTATTG -3'
(R):5'- TGCCAGGATTAGCAAGGACATG -3'

Sequencing Primer
(F):5'- ATTGCACGATGTCCTTGTAATTTTG -3'
(R):5'- GCTGGATTGCAAGCGCTATC -3'
Posted On2019-10-07