Incidental Mutation 'R7474:Csmd2'
ID 579327
Institutional Source Beutler Lab
Gene Symbol Csmd2
Ensembl Gene ENSMUSG00000028804
Gene Name CUB and Sushi multiple domains 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock # R7474 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 127987857-128567656 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 128546127 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 3125 (N3125D)
Ref Sequence ENSEMBL: ENSMUSP00000138958 (fasta)
AlphaFold no structure available at present
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,328,088 C3089* probably null Het
Abcc1 A G 16: 14,472,986 T1487A possibly damaging Het
Agfg1 T A 1: 82,882,411 L333* probably null Het
Agfg2 C A 5: 137,653,868 V410F possibly damaging Het
Amotl2 T C 9: 102,730,111 V706A probably benign Het
Apob A T 12: 8,009,185 T2556S probably benign Het
Asb18 T A 1: 89,993,033 H174L possibly damaging Het
Atp10a G A 7: 58,658,527 E25K unknown Het
Aup1 T C 6: 83,054,967 L65P probably benign Het
Blvra T C 2: 127,086,849 F86L probably damaging Het
Cabp4 T C 19: 4,139,399 D53G probably benign Het
Cd300c2 T A 11: 114,998,296 E153V probably benign Het
Crxos A G 7: 15,902,931 E143G possibly damaging Het
Cyp2c67 T A 19: 39,617,432 Q340L probably null Het
Dscam T A 16: 96,819,889 N540Y possibly damaging Het
E2f8 G A 7: 48,875,760 R155W probably damaging Het
Ext1 A T 15: 53,344,489 V292D probably damaging Het
Extl3 T C 14: 65,076,641 E364G possibly damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Fsd1 A T 17: 55,988,149 D46V possibly damaging Het
Gcnt2 T A 13: 40,958,257 L374H probably damaging Het
Gm10309 G A 17: 86,504,667 probably benign Het
Gm13084 T C 4: 143,811,699 D234G probably benign Het
Gm14410 A T 2: 177,202,825 probably null Het
Gm5114 A T 7: 39,407,980 S738R probably benign Het
Gtf3c2 C A 5: 31,167,756 G502W probably damaging Het
Insc G A 7: 114,768,823 probably null Het
Kcnt2 T C 1: 140,570,478 Y898H possibly damaging Het
Kctd19 C A 8: 105,392,032 R299L probably benign Het
Klf10 T C 15: 38,297,202 N198S probably benign Het
L3mbtl1 A T 2: 162,966,604 D574V probably damaging Het
Lamc1 G A 1: 153,332,265 A92V possibly damaging Het
Lrrc63 T A 14: 75,126,203 T163S possibly damaging Het
Mak T A 13: 41,051,480 K127N probably damaging Het
Mdga2 G A 12: 66,486,761 Q945* probably null Het
Mthfr T A 4: 148,052,602 I519N possibly damaging Het
Mtmr2 C A 9: 13,799,225 H357N probably damaging Het
Myh13 A T 11: 67,327,164 E21V possibly damaging Het
Myh13 A C 11: 67,367,711 Q184P Het
Nans T A 4: 46,502,484 L307Q probably damaging Het
Ncan C A 8: 70,102,041 R1042L possibly damaging Het
Nrg3 T C 14: 39,011,999 E310G probably damaging Het
Obsl1 A C 1: 75,498,184 N857K probably benign Het
Olfml2a T C 2: 38,960,261 V663A probably damaging Het
Olfr1104 T C 2: 87,022,554 probably benign Het
Olfr116 T C 17: 37,624,386 D83G probably benign Het
Olfr213 G T 6: 116,541,038 C195F probably damaging Het
Olfr603 A G 7: 103,383,762 I80T probably damaging Het
Olfr621-ps1 C A 7: 103,629,147 W271L unknown Het
Pla2g4a T C 1: 149,865,200 M363V possibly damaging Het
Prickle1 A T 15: 93,508,671 V157D possibly damaging Het
Pstk A G 7: 131,373,633 N105S probably benign Het
Ptpn21 A G 12: 98,737,363 probably null Het
Rnf2 T A 1: 151,471,716 E277D probably benign Het
Rnpepl1 T C 1: 92,918,972 F532S probably benign Het
Rtn1 C T 12: 72,308,390 A261T possibly damaging Het
Ryr2 A G 13: 11,594,876 S4355P probably benign Het
Sacs T G 14: 61,211,178 L3558V probably benign Het
Senp6 T C 9: 80,142,328 V1047A probably damaging Het
Slco2b1 A T 7: 99,664,832 C515S probably damaging Het
Smgc T A 15: 91,860,694 V732E possibly damaging Het
Sorcs1 T C 19: 50,153,112 M1105V possibly damaging Het
Spats1 A G 17: 45,457,161 Y160H possibly damaging Het
Tnfsf14 T A 17: 57,190,848 D128V Het
Tns3 T C 11: 8,530,894 Q234R probably damaging Het
Uxs1 A G 1: 43,757,024 V306A possibly damaging Het
Vac14 T A 8: 110,636,434 V304D probably damaging Het
Vangl1 A G 3: 102,184,249 F174L probably benign Het
Vav1 A G 17: 57,299,102 E242G probably benign Het
Vsir A G 10: 60,368,922 N305D probably benign Het
Vwce T A 19: 10,646,941 C399S possibly damaging Het
Wrn A T 8: 33,329,181 L248M probably damaging Het
Zfp141 T A 7: 42,476,254 K265* probably null Het
Zfp735 A T 11: 73,711,176 K315N possibly damaging Het
Other mutations in Csmd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Csmd2 APN 4 128483473 missense probably benign 0.03
IGL01098:Csmd2 APN 4 128059052 missense probably damaging 0.99
IGL01114:Csmd2 APN 4 128369130 missense probably benign 0.04
IGL01364:Csmd2 APN 4 128414288 missense probably benign 0.01
IGL01530:Csmd2 APN 4 128414301 missense possibly damaging 0.66
IGL01582:Csmd2 APN 4 128563305 nonsense probably null
IGL01670:Csmd2 APN 4 128513371 splice site probably benign
IGL01707:Csmd2 APN 4 128383005 missense possibly damaging 0.81
IGL01810:Csmd2 APN 4 128480845 splice site probably benign
IGL01837:Csmd2 APN 4 128419570 missense possibly damaging 0.92
IGL01924:Csmd2 APN 4 128559947 missense unknown
IGL02013:Csmd2 APN 4 128321323 missense possibly damaging 0.47
IGL02020:Csmd2 APN 4 128559879 missense probably damaging 1.00
IGL02037:Csmd2 APN 4 128477470 splice site probably benign
IGL02303:Csmd2 APN 4 128369008 missense probably benign 0.01
IGL02317:Csmd2 APN 4 128463727 splice site probably benign
IGL02322:Csmd2 APN 4 128463727 splice site probably benign
IGL02338:Csmd2 APN 4 128395066 missense possibly damaging 0.79
IGL02412:Csmd2 APN 4 128513372 splice site probably benign
IGL02428:Csmd2 APN 4 128474816 missense possibly damaging 0.82
IGL02491:Csmd2 APN 4 128534257 missense probably benign
IGL02701:Csmd2 APN 4 128496141 missense probably benign 0.17
IGL02801:Csmd2 APN 4 128552075 splice site probably null
IGL02818:Csmd2 APN 4 128209728 missense probably damaging 1.00
IGL02863:Csmd2 APN 4 128521884 missense probably benign 0.00
IGL02876:Csmd2 APN 4 128321335 nonsense probably null
IGL02977:Csmd2 APN 4 128493276 nonsense probably null
IGL03006:Csmd2 APN 4 128480765 splice site probably benign
IGL03032:Csmd2 APN 4 128519041 missense probably benign 0.03
IGL03148:Csmd2 APN 4 128384269 missense probably damaging 1.00
IGL03157:Csmd2 APN 4 128414299 nonsense probably null
IGL03245:Csmd2 APN 4 128509122 missense probably benign 0.12
IGL03376:Csmd2 APN 4 128517671 missense probably benign 0.03
IGL03014:Csmd2 UTSW 4 128296429 missense probably benign 0.01
R0109:Csmd2 UTSW 4 128544743 missense probably benign 0.03
R0112:Csmd2 UTSW 4 128496029 missense probably damaging 1.00
R0157:Csmd2 UTSW 4 128521911 missense probably benign 0.02
R0390:Csmd2 UTSW 4 128133673 intron probably benign
R0441:Csmd2 UTSW 4 128520230 missense probably benign 0.00
R0519:Csmd2 UTSW 4 128487005 missense possibly damaging 0.95
R0743:Csmd2 UTSW 4 128113676 missense probably benign 0.00
R0746:Csmd2 UTSW 4 128414297 missense probably damaging 1.00
R0973:Csmd2 UTSW 4 128496188 missense possibly damaging 0.91
R1019:Csmd2 UTSW 4 128522014 missense probably benign 0.00
R1476:Csmd2 UTSW 4 128487001 missense probably benign 0.08
R1641:Csmd2 UTSW 4 128483395 missense possibly damaging 0.68
R1709:Csmd2 UTSW 4 128496195 missense probably damaging 0.96
R2866:Csmd2 UTSW 4 128414392 critical splice donor site probably null
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2873:Csmd2 UTSW 4 128557718 missense unknown
R2893:Csmd2 UTSW 4 128538993 splice site probably null
R3796:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3797:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3798:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3914:Csmd2 UTSW 4 128321324 missense probably benign 0.07
R4198:Csmd2 UTSW 4 128510924 missense probably benign 0.07
R4489:Csmd2 UTSW 4 128381945 missense possibly damaging 0.68
R4571:Csmd2 UTSW 4 128480095 splice site probably null
R4581:Csmd2 UTSW 4 128369088 missense probably benign 0.02
R4599:Csmd2 UTSW 4 127988128 missense probably benign 0.35
R4649:Csmd2 UTSW 4 128546073 missense probably benign
R4706:Csmd2 UTSW 4 128544751 missense probably benign
R4776:Csmd2 UTSW 4 128442892 missense probably benign 0.09
R4838:Csmd2 UTSW 4 128517749 missense probably benign
R4900:Csmd2 UTSW 4 128452525 missense probably benign 0.03
R4999:Csmd2 UTSW 4 128521930 missense probably benign 0.00
R5024:Csmd2 UTSW 4 128321348 missense possibly damaging 0.94
R5034:Csmd2 UTSW 4 128059108 missense probably damaging 0.98
R5152:Csmd2 UTSW 4 128552035 missense probably benign 0.27
R5172:Csmd2 UTSW 4 128477397 missense probably benign 0.10
R5231:Csmd2 UTSW 4 128546049 missense probably benign 0.00
R5279:Csmd2 UTSW 4 128456914 missense probably benign 0.30
R5287:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5403:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5410:Csmd2 UTSW 4 128548819 missense probably benign
R5551:Csmd2 UTSW 4 128510948 missense possibly damaging 0.83
R5566:Csmd2 UTSW 4 128462889 critical splice donor site probably null
R5826:Csmd2 UTSW 4 128519199 splice site probably null
R5907:Csmd2 UTSW 4 128197385 missense probably damaging 0.99
R5913:Csmd2 UTSW 4 128551988 missense probably benign 0.01
R5970:Csmd2 UTSW 4 128546151 missense probably benign 0.00
R5977:Csmd2 UTSW 4 128059034 missense probably damaging 1.00
R6027:Csmd2 UTSW 4 128559946 missense unknown
R6075:Csmd2 UTSW 4 128486865 missense probably benign 0.15
R6129:Csmd2 UTSW 4 128493334 missense possibly damaging 0.79
R6363:Csmd2 UTSW 4 128400379 missense probably benign 0.00
R6366:Csmd2 UTSW 4 128483452 missense probably benign 0.00
R6404:Csmd2 UTSW 4 128521950 missense possibly damaging 0.90
R6437:Csmd2 UTSW 4 127988100 missense probably benign 0.24
R6441:Csmd2 UTSW 4 128394964 missense probably benign 0.03
R6643:Csmd2 UTSW 4 128372597 missense probably benign 0.14
R6724:Csmd2 UTSW 4 128563371 missense probably damaging 0.97
R6734:Csmd2 UTSW 4 128463813 missense probably benign 0.00
R6750:Csmd2 UTSW 4 128197225 missense possibly damaging 0.91
R6801:Csmd2 UTSW 4 128383950 missense probably benign 0.11
R6842:Csmd2 UTSW 4 128509159 missense possibly damaging 0.72
R6843:Csmd2 UTSW 4 128463794 missense probably benign 0.27
R6868:Csmd2 UTSW 4 128442840 missense probably benign
R6882:Csmd2 UTSW 4 128449269 missense probably benign 0.01
R7019:Csmd2 UTSW 4 128369063 missense
R7028:Csmd2 UTSW 4 128277228 missense
R7096:Csmd2 UTSW 4 128462726 missense
R7122:Csmd2 UTSW 4 128449227 missense
R7125:Csmd2 UTSW 4 128496162 missense
R7197:Csmd2 UTSW 4 128511033 missense
R7234:Csmd2 UTSW 4 128456779 missense
R7299:Csmd2 UTSW 4 128528262 missense
R7301:Csmd2 UTSW 4 128528262 missense
R7319:Csmd2 UTSW 4 128393679 missense
R7331:Csmd2 UTSW 4 128564228 splice site probably null
R7332:Csmd2 UTSW 4 128419567 missense
R7352:Csmd2 UTSW 4 128557636 missense
R7402:Csmd2 UTSW 4 128322095 missense
R7402:Csmd2 UTSW 4 128322096 missense
R7555:Csmd2 UTSW 4 128452458 missense
R7592:Csmd2 UTSW 4 128463798 missense
R7700:Csmd2 UTSW 4 128545756 splice site probably null
R7714:Csmd2 UTSW 4 128382950 nonsense probably null
R7734:Csmd2 UTSW 4 128552057 missense
R7735:Csmd2 UTSW 4 128456930 critical splice donor site probably null
R7757:Csmd2 UTSW 4 128483456 missense
R7805:Csmd2 UTSW 4 128419573 missense
R7823:Csmd2 UTSW 4 128209905 missense
R7904:Csmd2 UTSW 4 128419553 missense
R7946:Csmd2 UTSW 4 128520265 missense
R7964:Csmd2 UTSW 4 128523510 missense
R7968:Csmd2 UTSW 4 128197325 missense
R8003:Csmd2 UTSW 4 128539187 nonsense probably null
R8071:Csmd2 UTSW 4 128393538 missense
R8504:Csmd2 UTSW 4 128546690 missense
R8511:Csmd2 UTSW 4 128368899 missense
R8517:Csmd2 UTSW 4 128552686 missense
R8704:Csmd2 UTSW 4 128197354 missense
R8722:Csmd2 UTSW 4 128551950 unclassified probably benign
R8729:Csmd2 UTSW 4 128462845 missense
R8801:Csmd2 UTSW 4 128563402 missense probably damaging 0.97
R8803:Csmd2 UTSW 4 128546684 missense
R8839:Csmd2 UTSW 4 128442888 missense
R8867:Csmd2 UTSW 4 128557676 missense
R8913:Csmd2 UTSW 4 128523558 missense
R8928:Csmd2 UTSW 4 128475789 missense
R8974:Csmd2 UTSW 4 128552587 missense
R9001:Csmd2 UTSW 4 128414286 missense
R9132:Csmd2 UTSW 4 128549214 missense
R9245:Csmd2 UTSW 4 128306375 missense
R9249:Csmd2 UTSW 4 128419530 nonsense probably null
R9254:Csmd2 UTSW 4 128197319 missense
R9265:Csmd2 UTSW 4 128400370 missense
R9407:Csmd2 UTSW 4 128548820 missense
R9432:Csmd2 UTSW 4 128277211 missense
Z1177:Csmd2 UTSW 4 128530797 missense
Predicted Primers PCR Primer
(F):5'- GCTAGGAGTGACAAGCATTGTG -3'
(R):5'- GAGGATGCTTGAGGGTCAGATC -3'

Sequencing Primer
(F):5'- AGTGACAAGCATTGTGTCTTTC -3'
(R):5'- AGGGTCAGATCTTTCCTCAGGAC -3'
Posted On 2019-10-07