Incidental Mutation 'R7474:Ncan'
ID 579345
Institutional Source Beutler Lab
Gene Symbol Ncan
Ensembl Gene ENSMUSG00000002341
Gene Name neurocan
Synonyms Cspg3-rs, Tgfbit, Cspg3
MMRRC Submission 045548-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7474 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 70545735-70573494 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 70554691 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 1042 (R1042L)
Ref Sequence ENSEMBL: ENSMUSP00000002412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002412]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000002412
AA Change: R1042L

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000002412
Gene: ENSMUSG00000002341
AA Change: R1042L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 23 30 N/A INTRINSIC
IG 43 157 9.63e-6 SMART
LINK 157 254 2.22e-56 SMART
LINK 258 356 4.72e-60 SMART
low complexity region 575 586 N/A INTRINSIC
low complexity region 602 632 N/A INTRINSIC
low complexity region 663 677 N/A INTRINSIC
EGF 963 996 6.5e-5 SMART
EGF_CA 998 1034 9.77e-9 SMART
CLECT 1040 1161 1.97e-41 SMART
CCP 1167 1223 2.53e-12 SMART
low complexity region 1225 1256 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurocan is a chondroitin sulfate proteoglycan thought to be involved in the modulation of cell adhesion and migration.[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for targeted null mutations are viable and fertile and exhibit normal behavior and brain anatomy; however, mild defects in long term potentiation were noted. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,278,088 (GRCm39) C3089* probably null Het
Abcc1 A G 16: 14,290,850 (GRCm39) T1487A possibly damaging Het
Agfg1 T A 1: 82,860,132 (GRCm39) L333* probably null Het
Agfg2 C A 5: 137,652,130 (GRCm39) V410F possibly damaging Het
Amotl2 T C 9: 102,607,310 (GRCm39) V706A probably benign Het
Apob A T 12: 8,059,185 (GRCm39) T2556S probably benign Het
Asb18 T A 1: 89,920,755 (GRCm39) H174L possibly damaging Het
Atp10a G A 7: 58,308,275 (GRCm39) E25K unknown Het
Aup1 T C 6: 83,031,948 (GRCm39) L65P probably benign Het
Blvra T C 2: 126,928,769 (GRCm39) F86L probably damaging Het
Cabp4 T C 19: 4,189,398 (GRCm39) D53G probably benign Het
Cd300c2 T A 11: 114,889,122 (GRCm39) E153V probably benign Het
Crxos A G 7: 15,636,856 (GRCm39) E143G possibly damaging Het
Csmd2 A G 4: 128,439,920 (GRCm39) N3125D Het
Cyp2c67 T A 19: 39,605,876 (GRCm39) Q340L probably null Het
Dscam T A 16: 96,621,089 (GRCm39) N540Y possibly damaging Het
E2f8 G A 7: 48,525,508 (GRCm39) R155W probably damaging Het
Ext1 A T 15: 53,207,885 (GRCm39) V292D probably damaging Het
Extl3 T C 14: 65,314,090 (GRCm39) E364G possibly damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,436,769 (GRCm39) probably benign Het
Fsd1 A T 17: 56,295,149 (GRCm39) D46V possibly damaging Het
Gcnt2 T A 13: 41,111,733 (GRCm39) L374H probably damaging Het
Gm10309 G A 17: 86,812,095 (GRCm39) probably benign Het
Gm14410 A T 2: 176,894,618 (GRCm39) probably null Het
Gm5114 A T 7: 39,057,404 (GRCm39) S738R probably benign Het
Gtf3c2 C A 5: 31,325,100 (GRCm39) G502W probably damaging Het
Insc G A 7: 114,368,058 (GRCm39) probably null Het
Kcnt2 T C 1: 140,498,216 (GRCm39) Y898H possibly damaging Het
Kctd19 C A 8: 106,118,664 (GRCm39) R299L probably benign Het
Klf10 T C 15: 38,297,446 (GRCm39) N198S probably benign Het
L3mbtl1 A T 2: 162,808,524 (GRCm39) D574V probably damaging Het
Lamc1 G A 1: 153,208,011 (GRCm39) A92V possibly damaging Het
Lrrc63 T A 14: 75,363,643 (GRCm39) T163S possibly damaging Het
Mak T A 13: 41,204,956 (GRCm39) K127N probably damaging Het
Mdga2 G A 12: 66,533,535 (GRCm39) Q945* probably null Het
Mthfr T A 4: 148,137,059 (GRCm39) I519N possibly damaging Het
Mtmr2 C A 9: 13,710,521 (GRCm39) H357N probably damaging Het
Myh13 A C 11: 67,258,537 (GRCm39) Q184P Het
Myh13 A T 11: 67,217,990 (GRCm39) E21V possibly damaging Het
Nans T A 4: 46,502,484 (GRCm39) L307Q probably damaging Het
Nrg3 T C 14: 38,733,956 (GRCm39) E310G probably damaging Het
Obsl1 A C 1: 75,474,828 (GRCm39) N857K probably benign Het
Olfml2a T C 2: 38,850,273 (GRCm39) V663A probably damaging Het
Or14j10 T C 17: 37,935,277 (GRCm39) D83G probably benign Het
Or51v15-ps1 C A 7: 103,278,354 (GRCm39) W271L unknown Het
Or52e19b A G 7: 103,032,969 (GRCm39) I80T probably damaging Het
Or6d13 G T 6: 116,517,999 (GRCm39) C195F probably damaging Het
Or8i2 T C 2: 86,852,898 (GRCm39) probably benign Het
Pla2g4a T C 1: 149,740,951 (GRCm39) M363V possibly damaging Het
Pramel26 T C 4: 143,538,269 (GRCm39) D234G probably benign Het
Prickle1 A T 15: 93,406,552 (GRCm39) V157D possibly damaging Het
Pstk A G 7: 130,975,362 (GRCm39) N105S probably benign Het
Ptpn21 A G 12: 98,703,622 (GRCm39) probably null Het
Rnf2 T A 1: 151,347,467 (GRCm39) E277D probably benign Het
Rnpepl1 T C 1: 92,846,694 (GRCm39) F532S probably benign Het
Rtn1 C T 12: 72,355,164 (GRCm39) A261T possibly damaging Het
Ryr2 A G 13: 11,609,762 (GRCm39) S4355P probably benign Het
Sacs T G 14: 61,448,627 (GRCm39) L3558V probably benign Het
Senp6 T C 9: 80,049,610 (GRCm39) V1047A probably damaging Het
Slco2b1 A T 7: 99,314,039 (GRCm39) C515S probably damaging Het
Smgc T A 15: 91,744,892 (GRCm39) V732E possibly damaging Het
Sorcs1 T C 19: 50,141,550 (GRCm39) M1105V possibly damaging Het
Spats1 A G 17: 45,768,087 (GRCm39) Y160H possibly damaging Het
Tnfsf14 T A 17: 57,497,848 (GRCm39) D128V Het
Tns3 T C 11: 8,480,894 (GRCm39) Q234R probably damaging Het
Uxs1 A G 1: 43,796,184 (GRCm39) V306A possibly damaging Het
Vac14 T A 8: 111,363,066 (GRCm39) V304D probably damaging Het
Vangl1 A G 3: 102,091,565 (GRCm39) F174L probably benign Het
Vav1 A G 17: 57,606,102 (GRCm39) E242G probably benign Het
Vsir A G 10: 60,204,701 (GRCm39) N305D probably benign Het
Vwce T A 19: 10,624,305 (GRCm39) C399S possibly damaging Het
Wrn A T 8: 33,819,209 (GRCm39) L248M probably damaging Het
Zfp141 T A 7: 42,125,678 (GRCm39) K265* probably null Het
Zfp735 A T 11: 73,602,002 (GRCm39) K315N possibly damaging Het
Other mutations in Ncan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Ncan APN 8 70,567,921 (GRCm39) missense probably benign 0.24
IGL00924:Ncan APN 8 70,561,039 (GRCm39) missense possibly damaging 0.78
IGL01319:Ncan APN 8 70,550,212 (GRCm39) missense probably damaging 0.99
IGL01407:Ncan APN 8 70,554,607 (GRCm39) missense probably benign 0.17
IGL01528:Ncan APN 8 70,562,731 (GRCm39) missense probably benign 0.00
IGL01567:Ncan APN 8 70,560,984 (GRCm39) missense probably benign 0.09
IGL01808:Ncan APN 8 70,560,090 (GRCm39) critical splice donor site probably null
IGL02543:Ncan APN 8 70,561,221 (GRCm39) missense probably benign 0.37
IGL02551:Ncan APN 8 70,555,112 (GRCm39) missense probably damaging 1.00
IGL02899:Ncan APN 8 70,567,698 (GRCm39) missense possibly damaging 0.95
IGL02940:Ncan APN 8 70,562,735 (GRCm39) missense probably benign 0.02
IGL03058:Ncan APN 8 70,560,582 (GRCm39) missense possibly damaging 0.83
learned UTSW 8 70,550,731 (GRCm39) nonsense probably null
sagacious UTSW 8 70,565,240 (GRCm39) missense probably damaging 0.99
R0219:Ncan UTSW 8 70,567,984 (GRCm39) missense probably benign 0.08
R0538:Ncan UTSW 8 70,561,252 (GRCm39) missense possibly damaging 0.86
R0540:Ncan UTSW 8 70,567,809 (GRCm39) missense possibly damaging 0.93
R0854:Ncan UTSW 8 70,565,202 (GRCm39) missense probably damaging 1.00
R0918:Ncan UTSW 8 70,561,039 (GRCm39) missense possibly damaging 0.78
R1344:Ncan UTSW 8 70,560,819 (GRCm39) missense probably benign
R1575:Ncan UTSW 8 70,562,848 (GRCm39) missense probably benign 0.27
R1739:Ncan UTSW 8 70,560,736 (GRCm39) missense probably benign 0.03
R1847:Ncan UTSW 8 70,555,104 (GRCm39) missense probably damaging 0.96
R1859:Ncan UTSW 8 70,567,998 (GRCm39) missense possibly damaging 0.94
R2320:Ncan UTSW 8 70,560,868 (GRCm39) missense probably benign
R2370:Ncan UTSW 8 70,565,463 (GRCm39) missense probably benign 0.05
R3407:Ncan UTSW 8 70,564,801 (GRCm39) missense probably damaging 1.00
R3408:Ncan UTSW 8 70,564,801 (GRCm39) missense probably damaging 1.00
R3961:Ncan UTSW 8 70,562,950 (GRCm39) missense probably benign 0.05
R4155:Ncan UTSW 8 70,562,727 (GRCm39) missense possibly damaging 0.87
R4156:Ncan UTSW 8 70,562,727 (GRCm39) missense possibly damaging 0.87
R4365:Ncan UTSW 8 70,567,861 (GRCm39) missense probably damaging 1.00
R4858:Ncan UTSW 8 70,556,705 (GRCm39) missense probably benign 0.00
R4925:Ncan UTSW 8 70,562,604 (GRCm39) missense probably benign 0.02
R4942:Ncan UTSW 8 70,552,944 (GRCm39) missense probably damaging 1.00
R4976:Ncan UTSW 8 70,567,675 (GRCm39) missense probably damaging 0.98
R5119:Ncan UTSW 8 70,567,675 (GRCm39) missense probably damaging 0.98
R5141:Ncan UTSW 8 70,565,487 (GRCm39) missense probably damaging 1.00
R5679:Ncan UTSW 8 70,565,276 (GRCm39) missense probably damaging 1.00
R5706:Ncan UTSW 8 70,554,667 (GRCm39) missense probably damaging 0.99
R5915:Ncan UTSW 8 70,550,731 (GRCm39) nonsense probably null
R6033:Ncan UTSW 8 70,565,240 (GRCm39) missense probably damaging 0.99
R6033:Ncan UTSW 8 70,565,240 (GRCm39) missense probably damaging 0.99
R6223:Ncan UTSW 8 70,562,604 (GRCm39) missense probably benign 0.02
R6390:Ncan UTSW 8 70,567,899 (GRCm39) missense probably benign 0.34
R6533:Ncan UTSW 8 70,549,007 (GRCm39) missense probably benign 0.01
R6836:Ncan UTSW 8 70,552,965 (GRCm39) missense possibly damaging 0.84
R6869:Ncan UTSW 8 70,560,557 (GRCm39) missense probably benign 0.08
R7229:Ncan UTSW 8 70,552,961 (GRCm39) missense possibly damaging 0.69
R7232:Ncan UTSW 8 70,564,738 (GRCm39) missense probably damaging 1.00
R7293:Ncan UTSW 8 70,567,861 (GRCm39) missense probably damaging 0.98
R7406:Ncan UTSW 8 70,562,749 (GRCm39) missense probably benign 0.00
R7779:Ncan UTSW 8 70,567,661 (GRCm39) missense probably damaging 0.99
R7973:Ncan UTSW 8 70,550,225 (GRCm39) missense probably benign 0.00
R8113:Ncan UTSW 8 70,561,221 (GRCm39) missense possibly damaging 0.58
R8269:Ncan UTSW 8 70,560,330 (GRCm39) missense probably benign 0.01
R8947:Ncan UTSW 8 70,555,171 (GRCm39) missense probably damaging 0.98
R9324:Ncan UTSW 8 70,560,648 (GRCm39) missense possibly damaging 0.75
R9717:Ncan UTSW 8 70,554,628 (GRCm39) missense probably damaging 1.00
R9803:Ncan UTSW 8 70,560,751 (GRCm39) missense probably benign 0.06
Z1177:Ncan UTSW 8 70,550,122 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTCAAAGGACAAGTGCCAAC -3'
(R):5'- TAAATTACGGACACATAGCGGG -3'

Sequencing Primer
(F):5'- GGACAAGTGCCAACCCCAG -3'
(R):5'- TCAGACTTGGTGGCAATCAC -3'
Posted On 2019-10-07