Incidental Mutation 'R7474:Myh13'
ID 579355
Institutional Source Beutler Lab
Gene Symbol Myh13
Ensembl Gene ENSMUSG00000060180
Gene Name myosin, heavy polypeptide 13, skeletal muscle
Synonyms EO Myosin, MyHC-eo, extraocular myosin
MMRRC Submission 045548-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.157) question?
Stock # R7474 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 67217929-67262413 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 67258537 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Proline at position 184 (Q184P)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081911] [ENSMUST00000108684] [ENSMUST00000180845]
AlphaFold B1AR69
Predicted Effect probably benign
Transcript: ENSMUST00000081911
AA Change: Q1817P

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000080584
Gene: ENSMUSG00000060180
AA Change: Q1817P

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 8e-13 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
Pfam:Myosin_tail_1 847 1928 4.6e-159 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108684
AA Change: Q1817P

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000104324
Gene: ENSMUSG00000060180
AA Change: Q1817P

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.8e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
low complexity region 847 858 N/A INTRINSIC
low complexity region 925 940 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180845
AA Change: Q1817P

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000137731
Gene: ENSMUSG00000060180
AA Change: Q1817P

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.8e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
low complexity region 847 858 N/A INTRINSIC
low complexity region 925 940 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,278,088 (GRCm39) C3089* probably null Het
Abcc1 A G 16: 14,290,850 (GRCm39) T1487A possibly damaging Het
Agfg1 T A 1: 82,860,132 (GRCm39) L333* probably null Het
Agfg2 C A 5: 137,652,130 (GRCm39) V410F possibly damaging Het
Amotl2 T C 9: 102,607,310 (GRCm39) V706A probably benign Het
Apob A T 12: 8,059,185 (GRCm39) T2556S probably benign Het
Asb18 T A 1: 89,920,755 (GRCm39) H174L possibly damaging Het
Atp10a G A 7: 58,308,275 (GRCm39) E25K unknown Het
Aup1 T C 6: 83,031,948 (GRCm39) L65P probably benign Het
Blvra T C 2: 126,928,769 (GRCm39) F86L probably damaging Het
Cabp4 T C 19: 4,189,398 (GRCm39) D53G probably benign Het
Cd300c2 T A 11: 114,889,122 (GRCm39) E153V probably benign Het
Crxos A G 7: 15,636,856 (GRCm39) E143G possibly damaging Het
Csmd2 A G 4: 128,439,920 (GRCm39) N3125D Het
Cyp2c67 T A 19: 39,605,876 (GRCm39) Q340L probably null Het
Dscam T A 16: 96,621,089 (GRCm39) N540Y possibly damaging Het
E2f8 G A 7: 48,525,508 (GRCm39) R155W probably damaging Het
Ext1 A T 15: 53,207,885 (GRCm39) V292D probably damaging Het
Extl3 T C 14: 65,314,090 (GRCm39) E364G possibly damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,436,769 (GRCm39) probably benign Het
Fsd1 A T 17: 56,295,149 (GRCm39) D46V possibly damaging Het
Gcnt2 T A 13: 41,111,733 (GRCm39) L374H probably damaging Het
Gm10309 G A 17: 86,812,095 (GRCm39) probably benign Het
Gm14410 A T 2: 176,894,618 (GRCm39) probably null Het
Gm5114 A T 7: 39,057,404 (GRCm39) S738R probably benign Het
Gtf3c2 C A 5: 31,325,100 (GRCm39) G502W probably damaging Het
Insc G A 7: 114,368,058 (GRCm39) probably null Het
Kcnt2 T C 1: 140,498,216 (GRCm39) Y898H possibly damaging Het
Kctd19 C A 8: 106,118,664 (GRCm39) R299L probably benign Het
Klf10 T C 15: 38,297,446 (GRCm39) N198S probably benign Het
L3mbtl1 A T 2: 162,808,524 (GRCm39) D574V probably damaging Het
Lamc1 G A 1: 153,208,011 (GRCm39) A92V possibly damaging Het
Lrrc63 T A 14: 75,363,643 (GRCm39) T163S possibly damaging Het
Mak T A 13: 41,204,956 (GRCm39) K127N probably damaging Het
Mdga2 G A 12: 66,533,535 (GRCm39) Q945* probably null Het
Mthfr T A 4: 148,137,059 (GRCm39) I519N possibly damaging Het
Mtmr2 C A 9: 13,710,521 (GRCm39) H357N probably damaging Het
Nans T A 4: 46,502,484 (GRCm39) L307Q probably damaging Het
Ncan C A 8: 70,554,691 (GRCm39) R1042L possibly damaging Het
Nrg3 T C 14: 38,733,956 (GRCm39) E310G probably damaging Het
Obsl1 A C 1: 75,474,828 (GRCm39) N857K probably benign Het
Olfml2a T C 2: 38,850,273 (GRCm39) V663A probably damaging Het
Or14j10 T C 17: 37,935,277 (GRCm39) D83G probably benign Het
Or51v15-ps1 C A 7: 103,278,354 (GRCm39) W271L unknown Het
Or52e19b A G 7: 103,032,969 (GRCm39) I80T probably damaging Het
Or6d13 G T 6: 116,517,999 (GRCm39) C195F probably damaging Het
Or8i2 T C 2: 86,852,898 (GRCm39) probably benign Het
Pla2g4a T C 1: 149,740,951 (GRCm39) M363V possibly damaging Het
Pramel26 T C 4: 143,538,269 (GRCm39) D234G probably benign Het
Prickle1 A T 15: 93,406,552 (GRCm39) V157D possibly damaging Het
Pstk A G 7: 130,975,362 (GRCm39) N105S probably benign Het
Ptpn21 A G 12: 98,703,622 (GRCm39) probably null Het
Rnf2 T A 1: 151,347,467 (GRCm39) E277D probably benign Het
Rnpepl1 T C 1: 92,846,694 (GRCm39) F532S probably benign Het
Rtn1 C T 12: 72,355,164 (GRCm39) A261T possibly damaging Het
Ryr2 A G 13: 11,609,762 (GRCm39) S4355P probably benign Het
Sacs T G 14: 61,448,627 (GRCm39) L3558V probably benign Het
Senp6 T C 9: 80,049,610 (GRCm39) V1047A probably damaging Het
Slco2b1 A T 7: 99,314,039 (GRCm39) C515S probably damaging Het
Smgc T A 15: 91,744,892 (GRCm39) V732E possibly damaging Het
Sorcs1 T C 19: 50,141,550 (GRCm39) M1105V possibly damaging Het
Spats1 A G 17: 45,768,087 (GRCm39) Y160H possibly damaging Het
Tnfsf14 T A 17: 57,497,848 (GRCm39) D128V Het
Tns3 T C 11: 8,480,894 (GRCm39) Q234R probably damaging Het
Uxs1 A G 1: 43,796,184 (GRCm39) V306A possibly damaging Het
Vac14 T A 8: 111,363,066 (GRCm39) V304D probably damaging Het
Vangl1 A G 3: 102,091,565 (GRCm39) F174L probably benign Het
Vav1 A G 17: 57,606,102 (GRCm39) E242G probably benign Het
Vsir A G 10: 60,204,701 (GRCm39) N305D probably benign Het
Vwce T A 19: 10,624,305 (GRCm39) C399S possibly damaging Het
Wrn A T 8: 33,819,209 (GRCm39) L248M probably damaging Het
Zfp141 T A 7: 42,125,678 (GRCm39) K265* probably null Het
Zfp735 A T 11: 73,602,002 (GRCm39) K315N possibly damaging Het
Other mutations in Myh13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Myh13 APN 11 67,233,314 (GRCm39) missense probably damaging 1.00
IGL00808:Myh13 APN 11 67,225,830 (GRCm39) critical splice donor site probably null
IGL00822:Myh13 APN 11 67,252,154 (GRCm39) missense probably damaging 0.98
IGL00823:Myh13 APN 11 67,246,773 (GRCm39) missense probably benign 0.00
IGL00945:Myh13 APN 11 67,238,832 (GRCm39) missense probably null 1.00
IGL01414:Myh13 APN 11 67,233,298 (GRCm39) missense probably benign 0.02
IGL01482:Myh13 APN 11 67,242,894 (GRCm39) missense probably benign
IGL01523:Myh13 APN 11 67,238,769 (GRCm39) missense possibly damaging 0.73
IGL01723:Myh13 APN 11 67,260,045 (GRCm39) unclassified probably benign
IGL01997:Myh13 APN 11 67,257,992 (GRCm39) missense probably benign 0.14
IGL02369:Myh13 APN 11 67,251,100 (GRCm39) unclassified probably benign
IGL02478:Myh13 APN 11 67,260,204 (GRCm39) missense probably benign
IGL02663:Myh13 APN 11 67,245,753 (GRCm39) nonsense probably null
IGL02851:Myh13 APN 11 67,239,742 (GRCm39) missense possibly damaging 0.92
IGL02863:Myh13 APN 11 67,223,367 (GRCm39) missense probably damaging 1.00
IGL02929:Myh13 APN 11 67,257,991 (GRCm39) missense probably damaging 1.00
IGL02979:Myh13 APN 11 67,225,788 (GRCm39) missense possibly damaging 0.72
IGL03065:Myh13 APN 11 67,235,679 (GRCm39) missense probably damaging 0.99
IGL03214:Myh13 APN 11 67,244,411 (GRCm39) missense possibly damaging 0.79
IGL03223:Myh13 APN 11 67,241,068 (GRCm39) missense probably benign 0.39
IGL03231:Myh13 APN 11 67,242,817 (GRCm39) missense possibly damaging 0.94
IGL03407:Myh13 APN 11 67,242,978 (GRCm39) missense probably damaging 1.00
3-1:Myh13 UTSW 11 67,242,777 (GRCm39) splice site probably benign
P0042:Myh13 UTSW 11 67,225,817 (GRCm39) missense probably benign 0.00
R0047:Myh13 UTSW 11 67,258,063 (GRCm39) missense probably benign 0.00
R0047:Myh13 UTSW 11 67,258,063 (GRCm39) missense probably benign 0.00
R0379:Myh13 UTSW 11 67,260,121 (GRCm39) unclassified probably benign
R0496:Myh13 UTSW 11 67,239,641 (GRCm39) missense probably damaging 1.00
R0584:Myh13 UTSW 11 67,251,200 (GRCm39) nonsense probably null
R0595:Myh13 UTSW 11 67,235,672 (GRCm39) missense probably benign 0.03
R0621:Myh13 UTSW 11 67,232,058 (GRCm39) missense probably damaging 0.98
R0834:Myh13 UTSW 11 67,240,436 (GRCm39) missense possibly damaging 0.88
R0893:Myh13 UTSW 11 67,225,427 (GRCm39) missense probably damaging 1.00
R0964:Myh13 UTSW 11 67,235,828 (GRCm39) missense probably benign 0.02
R0973:Myh13 UTSW 11 67,223,346 (GRCm39) missense probably damaging 1.00
R0973:Myh13 UTSW 11 67,223,346 (GRCm39) missense probably damaging 1.00
R0974:Myh13 UTSW 11 67,223,346 (GRCm39) missense probably damaging 1.00
R1028:Myh13 UTSW 11 67,247,007 (GRCm39) missense possibly damaging 0.71
R1112:Myh13 UTSW 11 67,245,576 (GRCm39) missense probably damaging 1.00
R1283:Myh13 UTSW 11 67,261,747 (GRCm39) missense probably damaging 1.00
R1288:Myh13 UTSW 11 67,244,544 (GRCm39) missense probably benign 0.00
R1386:Myh13 UTSW 11 67,261,776 (GRCm39) missense possibly damaging 0.79
R1457:Myh13 UTSW 11 67,221,872 (GRCm39) missense probably damaging 0.97
R1503:Myh13 UTSW 11 67,244,500 (GRCm39) missense probably benign 0.43
R1574:Myh13 UTSW 11 67,253,407 (GRCm39) unclassified probably benign
R1673:Myh13 UTSW 11 67,242,945 (GRCm39) missense possibly damaging 0.79
R1693:Myh13 UTSW 11 67,232,310 (GRCm39) missense possibly damaging 0.95
R1763:Myh13 UTSW 11 67,225,402 (GRCm39) missense probably benign
R2029:Myh13 UTSW 11 67,252,115 (GRCm39) missense probably benign 0.03
R2030:Myh13 UTSW 11 67,241,064 (GRCm39) missense probably benign
R2247:Myh13 UTSW 11 67,225,384 (GRCm39) missense probably damaging 0.96
R2393:Myh13 UTSW 11 67,231,184 (GRCm39) missense possibly damaging 0.93
R2395:Myh13 UTSW 11 67,255,748 (GRCm39) missense probably benign 0.12
R2884:Myh13 UTSW 11 67,228,469 (GRCm39) missense probably benign 0.27
R3696:Myh13 UTSW 11 67,235,870 (GRCm39) missense possibly damaging 0.55
R3786:Myh13 UTSW 11 67,218,014 (GRCm39) missense probably benign 0.01
R3875:Myh13 UTSW 11 67,249,020 (GRCm39) missense probably benign 0.26
R3918:Myh13 UTSW 11 67,220,064 (GRCm39) missense probably benign 0.00
R4061:Myh13 UTSW 11 67,221,715 (GRCm39) missense possibly damaging 0.71
R4160:Myh13 UTSW 11 67,255,636 (GRCm39) intron probably benign
R4183:Myh13 UTSW 11 67,240,436 (GRCm39) missense possibly damaging 0.88
R4392:Myh13 UTSW 11 67,235,707 (GRCm39) splice site probably null
R4639:Myh13 UTSW 11 67,232,377 (GRCm39) missense possibly damaging 0.91
R4670:Myh13 UTSW 11 67,255,564 (GRCm39) nonsense probably null
R4783:Myh13 UTSW 11 67,232,096 (GRCm39) missense probably damaging 1.00
R4877:Myh13 UTSW 11 67,228,477 (GRCm39) missense probably damaging 0.99
R5250:Myh13 UTSW 11 67,218,085 (GRCm39) nonsense probably null
R5278:Myh13 UTSW 11 67,225,390 (GRCm39) missense probably benign 0.00
R5371:Myh13 UTSW 11 67,235,616 (GRCm39) splice site probably null
R5479:Myh13 UTSW 11 67,239,648 (GRCm39) missense probably damaging 0.97
R5510:Myh13 UTSW 11 67,228,549 (GRCm39) missense probably benign 0.05
R5690:Myh13 UTSW 11 67,220,101 (GRCm39) missense probably damaging 1.00
R5797:Myh13 UTSW 11 67,225,828 (GRCm39) missense possibly damaging 0.66
R5823:Myh13 UTSW 11 67,251,294 (GRCm39) missense probably damaging 1.00
R5877:Myh13 UTSW 11 67,244,484 (GRCm39) missense possibly damaging 0.78
R6041:Myh13 UTSW 11 67,255,556 (GRCm39) missense probably damaging 1.00
R6175:Myh13 UTSW 11 67,245,588 (GRCm39) missense probably benign 0.00
R6244:Myh13 UTSW 11 67,253,327 (GRCm39) missense probably benign 0.00
R6454:Myh13 UTSW 11 67,241,191 (GRCm39) missense probably benign 0.03
R6617:Myh13 UTSW 11 67,252,226 (GRCm39) missense probably benign 0.00
R6707:Myh13 UTSW 11 67,241,086 (GRCm39) missense probably damaging 1.00
R6747:Myh13 UTSW 11 67,241,245 (GRCm39) missense probably damaging 0.99
R6823:Myh13 UTSW 11 67,246,984 (GRCm39) missense probably benign
R6911:Myh13 UTSW 11 67,245,753 (GRCm39) nonsense probably null
R6997:Myh13 UTSW 11 67,217,980 (GRCm39) nonsense probably null
R7033:Myh13 UTSW 11 67,260,142 (GRCm39) missense possibly damaging 0.92
R7145:Myh13 UTSW 11 67,245,566 (GRCm39) missense probably benign 0.08
R7232:Myh13 UTSW 11 67,239,672 (GRCm39) missense probably damaging 1.00
R7428:Myh13 UTSW 11 67,223,390 (GRCm39) missense probably damaging 1.00
R7448:Myh13 UTSW 11 67,255,286 (GRCm39) critical splice acceptor site probably null
R7474:Myh13 UTSW 11 67,217,990 (GRCm39) missense possibly damaging 0.93
R7766:Myh13 UTSW 11 67,249,155 (GRCm39) missense probably benign 0.37
R7809:Myh13 UTSW 11 67,241,167 (GRCm39) missense probably benign 0.14
R7813:Myh13 UTSW 11 67,218,056 (GRCm39) missense probably benign 0.27
R7953:Myh13 UTSW 11 67,231,206 (GRCm39) missense probably damaging 1.00
R8085:Myh13 UTSW 11 67,225,613 (GRCm39) missense probably benign 0.00
R8397:Myh13 UTSW 11 67,241,113 (GRCm39) missense possibly damaging 0.62
R8434:Myh13 UTSW 11 67,254,011 (GRCm39) critical splice acceptor site probably null
R8490:Myh13 UTSW 11 67,255,351 (GRCm39) missense probably damaging 0.98
R8676:Myh13 UTSW 11 67,233,311 (GRCm39) missense probably damaging 1.00
R8681:Myh13 UTSW 11 67,242,960 (GRCm39) missense possibly damaging 0.49
R8777:Myh13 UTSW 11 67,252,161 (GRCm39) missense possibly damaging 0.92
R8777-TAIL:Myh13 UTSW 11 67,252,161 (GRCm39) missense possibly damaging 0.92
R8965:Myh13 UTSW 11 67,255,432 (GRCm39) missense probably benign 0.00
R9088:Myh13 UTSW 11 67,242,885 (GRCm39) missense probably damaging 1.00
R9151:Myh13 UTSW 11 67,252,149 (GRCm39) missense probably damaging 1.00
R9154:Myh13 UTSW 11 67,253,318 (GRCm39) missense probably benign
R9182:Myh13 UTSW 11 67,228,579 (GRCm39) missense probably damaging 1.00
R9332:Myh13 UTSW 11 67,254,109 (GRCm39) missense possibly damaging 0.57
R9393:Myh13 UTSW 11 67,242,894 (GRCm39) missense probably benign
R9446:Myh13 UTSW 11 67,255,325 (GRCm39) missense probably benign 0.01
R9474:Myh13 UTSW 11 67,255,712 (GRCm39) missense
R9690:Myh13 UTSW 11 67,249,194 (GRCm39) missense probably damaging 1.00
R9761:Myh13 UTSW 11 67,251,294 (GRCm39) missense probably damaging 1.00
R9778:Myh13 UTSW 11 67,249,016 (GRCm39) missense probably damaging 0.98
Z1176:Myh13 UTSW 11 67,220,121 (GRCm39) missense possibly damaging 0.93
Z1177:Myh13 UTSW 11 67,255,417 (GRCm39) missense possibly damaging 0.93
Z1177:Myh13 UTSW 11 67,241,278 (GRCm39) missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TGTCCTGTGAACTGACCCAG -3'
(R):5'- GAAGTGACATCAAAAGACGTTCTC -3'

Sequencing Primer
(F):5'- TGAACTGACCCAGGCCGC -3'
(R):5'- AAAAGACGTTCTCTTGGCCG -3'
Posted On 2019-10-07