Incidental Mutation 'R7474:Cd300c2'
ID579357
Institutional Source Beutler Lab
Gene Symbol Cd300c2
Ensembl Gene ENSMUSG00000044811
Gene NameCD300C molecule 2
SynonymsClm4, Cd300d, LMIR2, MAIR-II, AF251705, DIgR1, Igsf7
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7474 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location114996721-115001880 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 114998296 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 153 (E153V)
Ref Sequence ENSEMBL: ENSMUSP00000090121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092464] [ENSMUST00000141188]
Predicted Effect probably benign
Transcript: ENSMUST00000092464
AA Change: E153V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000090121
Gene: ENSMUSG00000044811
AA Change: E153V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 28 134 1.52e-3 SMART
transmembrane domain 187 209 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141188
SMART Domains Protein: ENSMUSP00000124035
Gene: ENSMUSG00000044811

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased stimulated B cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,328,088 C3089* probably null Het
Abcc1 A G 16: 14,472,986 T1487A possibly damaging Het
Agfg1 T A 1: 82,882,411 L333* probably null Het
Agfg2 C A 5: 137,653,868 V410F possibly damaging Het
Amotl2 T C 9: 102,730,111 V706A probably benign Het
Apob A T 12: 8,009,185 T2556S probably benign Het
Asb18 T A 1: 89,993,033 H174L possibly damaging Het
Atp10a G A 7: 58,658,527 E25K unknown Het
Aup1 T C 6: 83,054,967 L65P probably benign Het
Blvra T C 2: 127,086,849 F86L probably damaging Het
Cabp4 T C 19: 4,139,399 D53G probably benign Het
Crxos A G 7: 15,902,931 E143G possibly damaging Het
Csmd2 A G 4: 128,546,127 N3125D Het
Cyp2c67 T A 19: 39,617,432 Q340L probably null Het
Dscam T A 16: 96,819,889 N540Y possibly damaging Het
E2f8 G A 7: 48,875,760 R155W probably damaging Het
Ext1 A T 15: 53,344,489 V292D probably damaging Het
Extl3 T C 14: 65,076,641 E364G possibly damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Fsd1 A T 17: 55,988,149 D46V possibly damaging Het
Gcnt2 T A 13: 40,958,257 L374H probably damaging Het
Gm10309 G A 17: 86,504,667 probably benign Het
Gm13084 T C 4: 143,811,699 D234G probably benign Het
Gm14410 A T 2: 177,202,825 probably null Het
Gm5114 A T 7: 39,407,980 S738R probably benign Het
Gtf3c2 C A 5: 31,167,756 G502W probably damaging Het
Insc G A 7: 114,768,823 probably null Het
Kcnt2 T C 1: 140,570,478 Y898H possibly damaging Het
Kctd19 C A 8: 105,392,032 R299L probably benign Het
Klf10 T C 15: 38,297,202 N198S probably benign Het
L3mbtl1 A T 2: 162,966,604 D574V probably damaging Het
Lamc1 G A 1: 153,332,265 A92V possibly damaging Het
Lrrc63 T A 14: 75,126,203 T163S possibly damaging Het
Mak T A 13: 41,051,480 K127N probably damaging Het
Mdga2 G A 12: 66,486,761 Q945* probably null Het
Mthfr T A 4: 148,052,602 I519N possibly damaging Het
Mtmr2 C A 9: 13,799,225 H357N probably damaging Het
Myh13 A T 11: 67,327,164 E21V possibly damaging Het
Myh13 A C 11: 67,367,711 Q184P Het
Nans T A 4: 46,502,484 L307Q probably damaging Het
Ncan C A 8: 70,102,041 R1042L possibly damaging Het
Nrg3 T C 14: 39,011,999 E310G probably damaging Het
Obsl1 A C 1: 75,498,184 N857K probably benign Het
Olfml2a T C 2: 38,960,261 V663A probably damaging Het
Olfr1104 T C 2: 87,022,554 probably benign Het
Olfr116 T C 17: 37,624,386 D83G probably benign Het
Olfr213 G T 6: 116,541,038 C195F probably damaging Het
Olfr603 A G 7: 103,383,762 I80T probably damaging Het
Olfr621-ps1 C A 7: 103,629,147 W271L unknown Het
Pla2g4a T C 1: 149,865,200 M363V possibly damaging Het
Prickle1 A T 15: 93,508,671 V157D possibly damaging Het
Pstk A G 7: 131,373,633 N105S probably benign Het
Ptpn21 A G 12: 98,737,363 probably null Het
Rnf2 T A 1: 151,471,716 E277D probably benign Het
Rnpepl1 T C 1: 92,918,972 F532S probably benign Het
Rtn1 C T 12: 72,308,390 A261T possibly damaging Het
Ryr2 A G 13: 11,594,876 S4355P probably benign Het
Sacs T G 14: 61,211,178 L3558V probably benign Het
Senp6 T C 9: 80,142,328 V1047A probably damaging Het
Slco2b1 A T 7: 99,664,832 C515S probably damaging Het
Smgc T A 15: 91,860,694 V732E possibly damaging Het
Sorcs1 T C 19: 50,153,112 M1105V possibly damaging Het
Spats1 A G 17: 45,457,161 Y160H possibly damaging Het
Tnfsf14 T A 17: 57,190,848 D128V Het
Tns3 T C 11: 8,530,894 Q234R probably damaging Het
Uxs1 A G 1: 43,757,024 V306A possibly damaging Het
Vac14 T A 8: 110,636,434 V304D probably damaging Het
Vangl1 A G 3: 102,184,249 F174L probably benign Het
Vav1 A G 17: 57,299,102 E242G probably benign Het
Vsir A G 10: 60,368,922 N305D probably benign Het
Vwce T A 19: 10,646,941 C399S possibly damaging Het
Wrn A T 8: 33,329,181 L248M probably damaging Het
Zfp141 T A 7: 42,476,254 K265* probably null Het
Zfp735 A T 11: 73,711,176 K315N possibly damaging Het
Other mutations in Cd300c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cd300c2 APN 11 115001549 utr 5 prime probably benign
IGL02695:Cd300c2 APN 11 115001553 utr 5 prime probably benign
IGL03086:Cd300c2 APN 11 115000823 missense possibly damaging 0.76
R1933:Cd300c2 UTSW 11 115000859 missense probably benign 0.22
R4707:Cd300c2 UTSW 11 114996985 missense probably benign 0.03
R4866:Cd300c2 UTSW 11 115000981 nonsense probably null
R4900:Cd300c2 UTSW 11 115000981 nonsense probably null
R4906:Cd300c2 UTSW 11 114997000 missense possibly damaging 0.85
R4908:Cd300c2 UTSW 11 114996946 missense probably damaging 0.97
R4946:Cd300c2 UTSW 11 114996905 missense probably benign 0.04
R5568:Cd300c2 UTSW 11 115000836 missense probably damaging 1.00
R6870:Cd300c2 UTSW 11 115000677 missense probably damaging 0.99
R7826:Cd300c2 UTSW 11 115000818 missense possibly damaging 0.77
R8210:Cd300c2 UTSW 11 115000808 missense possibly damaging 0.89
R8443:Cd300c2 UTSW 11 115000640 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- CAGGTCAGCCTATGATTGGG -3'
(R):5'- TGGGCTAGGAAGAAAATCCCTG -3'

Sequencing Primer
(F):5'- TCAGCCTATGATTGGGAAATGC -3'
(R):5'- CTGACCAGGCCTTAGTGTG -3'
Posted On2019-10-07