Incidental Mutation 'R7474:Ptpn21'
ID579361
Institutional Source Beutler Lab
Gene Symbol Ptpn21
Ensembl Gene ENSMUSG00000021009
Gene Nameprotein tyrosine phosphatase, non-receptor type 21
SynonymsPTPD1, PTPRL10
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R7474 (G1)
Quality Score141.008
Status Not validated
Chromosome12
Chromosomal Location98676741-98737405 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 98737363 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085116] [ENSMUST00000170188] [ENSMUST00000221148] [ENSMUST00000221535] [ENSMUST00000221932]
Predicted Effect probably benign
Transcript: ENSMUST00000085116
SMART Domains Protein: ENSMUSP00000082197
Gene: ENSMUSG00000021009

DomainStartEndE-ValueType
B41 19 222 5.04e-69 SMART
FERM_C 226 312 4.66e-26 SMART
low complexity region 332 343 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
low complexity region 710 724 N/A INTRINSIC
PTPc 897 1171 7.31e-111 SMART
Predicted Effect probably null
Transcript: ENSMUST00000170188
SMART Domains Protein: ENSMUSP00000126975
Gene: ENSMUSG00000021009

DomainStartEndE-ValueType
B41 19 222 5.04e-69 SMART
FERM_C 226 312 4.66e-26 SMART
low complexity region 332 343 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
low complexity region 710 724 N/A INTRINSIC
PTPc 897 1171 7.31e-111 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221148
Predicted Effect probably benign
Transcript: ENSMUST00000221535
Predicted Effect probably benign
Transcript: ENSMUST00000221932
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an N-terminal domain, similar to cytoskeletal- associated proteins including band 4.1, ezrin, merlin, and radixin. This PTP was shown to specially interact with BMX/ETK, a member of Tec tyrosine kinase family characterized by a multimodular structures including PH, SH3, and SH2 domains. The interaction of this PTP with BMX kinase was found to increase the activation of STAT3, but not STAT2 kinase. Studies of the similar gene in mice suggested the possible roles of this PTP in liver regeneration and spermatogenesis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,328,088 C3089* probably null Het
Abcc1 A G 16: 14,472,986 T1487A possibly damaging Het
Agfg1 T A 1: 82,882,411 L333* probably null Het
Agfg2 C A 5: 137,653,868 V410F possibly damaging Het
Amotl2 T C 9: 102,730,111 V706A probably benign Het
Apob A T 12: 8,009,185 T2556S probably benign Het
Asb18 T A 1: 89,993,033 H174L possibly damaging Het
Atp10a G A 7: 58,658,527 E25K unknown Het
Aup1 T C 6: 83,054,967 L65P probably benign Het
Blvra T C 2: 127,086,849 F86L probably damaging Het
Cabp4 T C 19: 4,139,399 D53G probably benign Het
Cd300c2 T A 11: 114,998,296 E153V probably benign Het
Crxos A G 7: 15,902,931 E143G possibly damaging Het
Csmd2 A G 4: 128,546,127 N3125D Het
Cyp2c67 T A 19: 39,617,432 Q340L probably null Het
Dscam T A 16: 96,819,889 N540Y possibly damaging Het
E2f8 G A 7: 48,875,760 R155W probably damaging Het
Ext1 A T 15: 53,344,489 V292D probably damaging Het
Extl3 T C 14: 65,076,641 E364G possibly damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Fsd1 A T 17: 55,988,149 D46V possibly damaging Het
Gcnt2 T A 13: 40,958,257 L374H probably damaging Het
Gm10309 G A 17: 86,504,667 probably benign Het
Gm13084 T C 4: 143,811,699 D234G probably benign Het
Gm14410 A T 2: 177,202,825 probably null Het
Gm5114 A T 7: 39,407,980 S738R probably benign Het
Gtf3c2 C A 5: 31,167,756 G502W probably damaging Het
Insc G A 7: 114,768,823 probably null Het
Kcnt2 T C 1: 140,570,478 Y898H possibly damaging Het
Kctd19 C A 8: 105,392,032 R299L probably benign Het
Klf10 T C 15: 38,297,202 N198S probably benign Het
L3mbtl1 A T 2: 162,966,604 D574V probably damaging Het
Lamc1 G A 1: 153,332,265 A92V possibly damaging Het
Lrrc63 T A 14: 75,126,203 T163S possibly damaging Het
Mak T A 13: 41,051,480 K127N probably damaging Het
Mdga2 G A 12: 66,486,761 Q945* probably null Het
Mthfr T A 4: 148,052,602 I519N possibly damaging Het
Mtmr2 C A 9: 13,799,225 H357N probably damaging Het
Myh13 A T 11: 67,327,164 E21V possibly damaging Het
Myh13 A C 11: 67,367,711 Q184P Het
Nans T A 4: 46,502,484 L307Q probably damaging Het
Ncan C A 8: 70,102,041 R1042L possibly damaging Het
Nrg3 T C 14: 39,011,999 E310G probably damaging Het
Obsl1 A C 1: 75,498,184 N857K probably benign Het
Olfml2a T C 2: 38,960,261 V663A probably damaging Het
Olfr1104 T C 2: 87,022,554 probably benign Het
Olfr116 T C 17: 37,624,386 D83G probably benign Het
Olfr213 G T 6: 116,541,038 C195F probably damaging Het
Olfr603 A G 7: 103,383,762 I80T probably damaging Het
Olfr621-ps1 C A 7: 103,629,147 W271L unknown Het
Pla2g4a T C 1: 149,865,200 M363V possibly damaging Het
Prickle1 A T 15: 93,508,671 V157D possibly damaging Het
Pstk A G 7: 131,373,633 N105S probably benign Het
Rnf2 T A 1: 151,471,716 E277D probably benign Het
Rnpepl1 T C 1: 92,918,972 F532S probably benign Het
Rtn1 C T 12: 72,308,390 A261T possibly damaging Het
Ryr2 A G 13: 11,594,876 S4355P probably benign Het
Sacs T G 14: 61,211,178 L3558V probably benign Het
Senp6 T C 9: 80,142,328 V1047A probably damaging Het
Slco2b1 A T 7: 99,664,832 C515S probably damaging Het
Smgc T A 15: 91,860,694 V732E possibly damaging Het
Sorcs1 T C 19: 50,153,112 M1105V possibly damaging Het
Spats1 A G 17: 45,457,161 Y160H possibly damaging Het
Tnfsf14 T A 17: 57,190,848 D128V Het
Tns3 T C 11: 8,530,894 Q234R probably damaging Het
Uxs1 A G 1: 43,757,024 V306A possibly damaging Het
Vac14 T A 8: 110,636,434 V304D probably damaging Het
Vangl1 A G 3: 102,184,249 F174L probably benign Het
Vav1 A G 17: 57,299,102 E242G probably benign Het
Vsir A G 10: 60,368,922 N305D probably benign Het
Vwce T A 19: 10,646,941 C399S possibly damaging Het
Wrn A T 8: 33,329,181 L248M probably damaging Het
Zfp141 T A 7: 42,476,254 K265* probably null Het
Zfp735 A T 11: 73,711,176 K315N possibly damaging Het
Other mutations in Ptpn21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Ptpn21 APN 12 98680468 missense probably damaging 1.00
IGL00576:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00577:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00580:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00583:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00773:Ptpn21 APN 12 98688313 missense probably benign 0.00
IGL00780:Ptpn21 APN 12 98680371 missense probably damaging 1.00
IGL01516:Ptpn21 APN 12 98715189 missense probably damaging 1.00
IGL01616:Ptpn21 APN 12 98680013 missense probably damaging 1.00
IGL01939:Ptpn21 APN 12 98689161 missense probably damaging 0.96
IGL02237:Ptpn21 APN 12 98705092 critical splice donor site probably null
IGL02512:Ptpn21 APN 12 98679392 missense probably benign 0.00
IGL02852:Ptpn21 APN 12 98715195 critical splice acceptor site probably null
IGL02894:Ptpn21 APN 12 98689632 splice site probably benign
IGL03024:Ptpn21 APN 12 98680056 missense probably benign
IGL03220:Ptpn21 APN 12 98678623 missense probably damaging 1.00
R0144:Ptpn21 UTSW 12 98688609 missense probably benign 0.01
R0472:Ptpn21 UTSW 12 98704240 splice site probably benign
R0675:Ptpn21 UTSW 12 98688216 missense probably benign 0.16
R0771:Ptpn21 UTSW 12 98689080 missense probably damaging 1.00
R1434:Ptpn21 UTSW 12 98688590 missense probably damaging 1.00
R1470:Ptpn21 UTSW 12 98688476 missense probably benign
R1470:Ptpn21 UTSW 12 98688476 missense probably benign
R1837:Ptpn21 UTSW 12 98733626 missense probably damaging 0.99
R1897:Ptpn21 UTSW 12 98680405 unclassified probably null
R2048:Ptpn21 UTSW 12 98689526 missense possibly damaging 0.94
R2376:Ptpn21 UTSW 12 98688314 missense possibly damaging 0.62
R3709:Ptpn21 UTSW 12 98688541 missense probably benign
R4197:Ptpn21 UTSW 12 98680138 missense probably damaging 1.00
R4283:Ptpn21 UTSW 12 98733475 missense probably damaging 0.99
R4368:Ptpn21 UTSW 12 98678593 missense probably damaging 1.00
R4397:Ptpn21 UTSW 12 98688248 missense probably damaging 1.00
R4397:Ptpn21 UTSW 12 98715060 missense probably damaging 0.98
R4703:Ptpn21 UTSW 12 98679392 missense probably benign 0.00
R4737:Ptpn21 UTSW 12 98708844 missense probably benign 0.03
R4829:Ptpn21 UTSW 12 98689296 missense probably damaging 1.00
R4926:Ptpn21 UTSW 12 98715195 critical splice acceptor site probably null
R4974:Ptpn21 UTSW 12 98680103 missense probably damaging 1.00
R5022:Ptpn21 UTSW 12 98679407 missense probably damaging 1.00
R5057:Ptpn21 UTSW 12 98679407 missense probably damaging 1.00
R5395:Ptpn21 UTSW 12 98715117 missense probably damaging 1.00
R5608:Ptpn21 UTSW 12 98688777 missense probably benign 0.00
R5741:Ptpn21 UTSW 12 98679289 missense probably damaging 1.00
R5785:Ptpn21 UTSW 12 98682550 missense probably damaging 0.99
R5959:Ptpn21 UTSW 12 98708889 splice site probably null
R5968:Ptpn21 UTSW 12 98710890 missense probably damaging 1.00
R5984:Ptpn21 UTSW 12 98689076 missense probably damaging 1.00
R6005:Ptpn21 UTSW 12 98678552 makesense probably null
R6181:Ptpn21 UTSW 12 98699999 missense probably damaging 0.99
R6226:Ptpn21 UTSW 12 98680116 missense probably benign 0.24
R6226:Ptpn21 UTSW 12 98715172 missense probably damaging 1.00
R6317:Ptpn21 UTSW 12 98689262 missense probably damaging 1.00
R6370:Ptpn21 UTSW 12 98689034 missense possibly damaging 0.86
R6485:Ptpn21 UTSW 12 98698872 nonsense probably null
R6894:Ptpn21 UTSW 12 98715181 missense probably damaging 1.00
R7122:Ptpn21 UTSW 12 98688912 missense probably damaging 0.99
R7232:Ptpn21 UTSW 12 98688737 missense probably benign 0.17
R7289:Ptpn21 UTSW 12 98704191 missense probably benign 0.35
R7327:Ptpn21 UTSW 12 98680101 missense probably damaging 1.00
R7748:Ptpn21 UTSW 12 98688772 missense probably benign 0.01
R7816:Ptpn21 UTSW 12 98682532 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCGAGAGTCACAAATATGCC -3'
(R):5'- TCCAACTCTCTGAGGTCACG -3'

Sequencing Primer
(F):5'- GAGTCACAAATATGCCCAAGATTTC -3'
(R):5'- GAGCTCCCCCAGAGAGTG -3'
Posted On2019-10-07