Mutagenetix > Incidental Mutation

Incidental Mutation 'R7474:Dscam'

579374

Institutional Source

Beutler Lab

Gene Symbol

Dscam

Ensembl Gene

ENSMUSG00000050272

Gene Name

DS cell adhesion molecule

Synonyms

4932410A21Rik

MMRRC Submission

Accession Numbers

Genbank: NM_031174; MGI: 1196281

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7474 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

96592079-97170752 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 96819889 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 540 (N540Y)

Ref Sequence

ENSEMBL: ENSMUSP00000056040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056102]

AlphaFold

Q9ERC8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000056102
AA Change: N540Y

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000056040
Gene: ENSMUSG00000050272
AA Change: N540Y

Domain	Start	End	E-Value	Type
IG_like	37	109	1.47e0	SMART
IG	130	218	8.33e-1	SMART
IGc2	237	300	8.7e-13	SMART
IGc2	326	392	1.24e-8	SMART
IGc2	419	491	1.1e-9	SMART
IGc2	516	582	1.99e-7	SMART
IGc2	608	676	1.84e-11	SMART
IGc2	702	773	6.01e-16	SMART
IG	794	883	1.73e-7	SMART
FN3	885	969	7.34e-9	SMART
FN3	985	1073	4.06e-11	SMART
FN3	1088	1174	7.23e-8	SMART
FN3	1189	1270	2.6e-9	SMART
IGc2	1301	1366	2.05e-9	SMART
FN3	1380	1460	7.17e-12	SMART
FN3	1477	1557	4.35e1	SMART
transmembrane domain	1595	1617	N/A	INTRINSIC
low complexity region	1799	1809	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

Strain: 4830358; 3840666;5305025;3761008
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the immunoglobulin superfamily of cell adhesion molecules (Ig-CAMs), and is involved in human central and peripheral nervous system development. This gene is a candidate for Down syndrome and congenital heart disease (DSCHD). A gene encoding a similar Ig-CAM protein is located on chromosome 11. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit background-sensitive perinatal lethality associated with respiratory distress, altered C4 ventral root and pre-inspiratory neuron signaling, and abnormal response to hypercapnia. [provided by MGI curators]

Allele List at MGI

All alleles(9) : Targeted(6) Gene trapped(1) Spontaneous(2)

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	A	11: 9,328,088	C3089*	probably null	Het
Abcc1	A	G	16: 14,472,986	T1487A	possibly damaging	Het
Agfg1	T	A	1: 82,882,411	L333*	probably null	Het
Agfg2	C	A	5: 137,653,868	V410F	possibly damaging	Het
Amotl2	T	C	9: 102,730,111	V706A	probably benign	Het
Apob	A	T	12: 8,009,185	T2556S	probably benign	Het
Asb18	T	A	1: 89,993,033	H174L	possibly damaging	Het
Atp10a	G	A	7: 58,658,527	E25K	unknown	Het
Aup1	T	C	6: 83,054,967	L65P	probably benign	Het
Blvra	T	C	2: 127,086,849	F86L	probably damaging	Het
Cabp4	T	C	19: 4,139,399	D53G	probably benign	Het
Cd300c2	T	A	11: 114,998,296	E153V	probably benign	Het
Crxos	A	G	7: 15,902,931	E143G	possibly damaging	Het
Csmd2	A	G	4: 128,546,127	N3125D		Het
Cyp2c67	T	A	19: 39,617,432	Q340L	probably null	Het
E2f8	G	A	7: 48,875,760	R155W	probably damaging	Het
Ext1	A	T	15: 53,344,489	V292D	probably damaging	Het
Extl3	T	C	14: 65,076,641	E364G	possibly damaging	Het
Fmn2	CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC	CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC	1: 174,609,203		probably benign	Het
Fsd1	A	T	17: 55,988,149	D46V	possibly damaging	Het
Gcnt2	T	A	13: 40,958,257	L374H	probably damaging	Het
Gm10309	G	A	17: 86,504,667		probably benign	Het
Gm13084	T	C	4: 143,811,699	D234G	probably benign	Het
Gm14410	A	T	2: 177,202,825		probably null	Het
Gm5114	A	T	7: 39,407,980	S738R	probably benign	Het
Gtf3c2	C	A	5: 31,167,756	G502W	probably damaging	Het
Insc	G	A	7: 114,768,823		probably null	Het
Kcnt2	T	C	1: 140,570,478	Y898H	possibly damaging	Het
Kctd19	C	A	8: 105,392,032	R299L	probably benign	Het
Klf10	T	C	15: 38,297,202	N198S	probably benign	Het
L3mbtl1	A	T	2: 162,966,604	D574V	probably damaging	Het
Lamc1	G	A	1: 153,332,265	A92V	possibly damaging	Het
Lrrc63	T	A	14: 75,126,203	T163S	possibly damaging	Het
Mak	T	A	13: 41,051,480	K127N	probably damaging	Het
Mdga2	G	A	12: 66,486,761	Q945*	probably null	Het
Mthfr	T	A	4: 148,052,602	I519N	possibly damaging	Het
Mtmr2	C	A	9: 13,799,225	H357N	probably damaging	Het
Myh13	A	T	11: 67,327,164	E21V	possibly damaging	Het
Myh13	A	C	11: 67,367,711	Q184P		Het
Nans	T	A	4: 46,502,484	L307Q	probably damaging	Het
Ncan	C	A	8: 70,102,041	R1042L	possibly damaging	Het
Nrg3	T	C	14: 39,011,999	E310G	probably damaging	Het
Obsl1	A	C	1: 75,498,184	N857K	probably benign	Het
Olfml2a	T	C	2: 38,960,261	V663A	probably damaging	Het
Olfr1104	T	C	2: 87,022,554		probably benign	Het
Olfr116	T	C	17: 37,624,386	D83G	probably benign	Het
Olfr213	G	T	6: 116,541,038	C195F	probably damaging	Het
Olfr603	A	G	7: 103,383,762	I80T	probably damaging	Het
Olfr621-ps1	C	A	7: 103,629,147	W271L	unknown	Het
Pla2g4a	T	C	1: 149,865,200	M363V	possibly damaging	Het
Prickle1	A	T	15: 93,508,671	V157D	possibly damaging	Het
Pstk	A	G	7: 131,373,633	N105S	probably benign	Het
Ptpn21	A	G	12: 98,737,363		probably null	Het
Rnf2	T	A	1: 151,471,716	E277D	probably benign	Het
Rnpepl1	T	C	1: 92,918,972	F532S	probably benign	Het
Rtn1	C	T	12: 72,308,390	A261T	possibly damaging	Het
Ryr2	A	G	13: 11,594,876	S4355P	probably benign	Het
Sacs	T	G	14: 61,211,178	L3558V	probably benign	Het
Senp6	T	C	9: 80,142,328	V1047A	probably damaging	Het
Slco2b1	A	T	7: 99,664,832	C515S	probably damaging	Het
Smgc	T	A	15: 91,860,694	V732E	possibly damaging	Het
Sorcs1	T	C	19: 50,153,112	M1105V	possibly damaging	Het
Spats1	A	G	17: 45,457,161	Y160H	possibly damaging	Het
Tnfsf14	T	A	17: 57,190,848	D128V		Het
Tns3	T	C	11: 8,530,894	Q234R	probably damaging	Het
Uxs1	A	G	1: 43,757,024	V306A	possibly damaging	Het
Vac14	T	A	8: 110,636,434	V304D	probably damaging	Het
Vangl1	A	G	3: 102,184,249	F174L	probably benign	Het
Vav1	A	G	17: 57,299,102	E242G	probably benign	Het
Vsir	A	G	10: 60,368,922	N305D	probably benign	Het
Vwce	T	A	19: 10,646,941	C399S	possibly damaging	Het
Wrn	A	T	8: 33,329,181	L248M	probably damaging	Het
Zfp141	T	A	7: 42,476,254	K265*	probably null	Het
Zfp735	A	T	11: 73,711,176	K315N	possibly damaging	Het

Other mutations in Dscam

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00515:Dscam	APN	16	96608065	missense	possibly damaging	0.64
IGL00841:Dscam	APN	16	96819877	missense	probably damaging	1.00
IGL01289:Dscam	APN	16	96643882	nonsense	probably null
IGL01358:Dscam	APN	16	96610343	missense	possibly damaging	0.68
IGL01431:Dscam	APN	16	96652078	critical splice donor site	probably null
IGL01444:Dscam	APN	16	96673709	missense	possibly damaging	0.95
IGL01767:Dscam	APN	16	96654936	missense	probably damaging	1.00
IGL01866:Dscam	APN	16	96685350	missense	probably benign	0.06
IGL02020:Dscam	APN	16	96716069	missense	probably damaging	1.00
IGL02023:Dscam	APN	16	96801197	missense	probably benign	0.06
IGL02057:Dscam	APN	16	96716073	nonsense	probably null
IGL02389:Dscam	APN	16	96640897	missense	probably benign	0.27
IGL02409:Dscam	APN	16	96819888	missense	possibly damaging	0.46
IGL02694:Dscam	APN	16	96593276	missense	probably benign	0.00
IGL02899:Dscam	APN	16	96709247	missense	probably damaging	0.98
IGL02956:Dscam	APN	16	96801272	missense	probably damaging	0.98
IGL03035:Dscam	APN	16	96819970	missense	possibly damaging	0.94
IGL03191:Dscam	APN	16	96820769	missense	probably benign	0.36
growler	UTSW	16	96820997	missense	probably damaging	0.99
Twostep	UTSW	16	96825782	splice site	probably null
F6893:Dscam	UTSW	16	97056460	missense	possibly damaging	0.78
K3955:Dscam	UTSW	16	96673687	missense	probably benign	0.00
R0024:Dscam	UTSW	16	96593385	nonsense	probably null
R0057:Dscam	UTSW	16	96673736	missense	probably damaging	1.00
R0057:Dscam	UTSW	16	96673736	missense	probably damaging	1.00
R0117:Dscam	UTSW	16	96673678	missense	probably benign	0.33
R0211:Dscam	UTSW	16	96716079	missense	possibly damaging	0.50
R0280:Dscam	UTSW	16	97039006	missense	possibly damaging	0.62
R0355:Dscam	UTSW	16	96654905	missense	probably benign	0.00
R0380:Dscam	UTSW	16	97056610	missense	probably damaging	1.00
R0445:Dscam	UTSW	16	96772503	missense	probably damaging	1.00
R0492:Dscam	UTSW	16	96825782	splice site	probably null
R0534:Dscam	UTSW	16	96652172	missense	possibly damaging	0.67
R0593:Dscam	UTSW	16	96772408	missense	probably benign	0.19
R0707:Dscam	UTSW	16	96825782	splice site	probably null
R0738:Dscam	UTSW	16	96819781	missense	possibly damaging	0.48
R1017:Dscam	UTSW	16	96833433	missense	probably damaging	1.00
R1377:Dscam	UTSW	16	96772494	missense	probably damaging	1.00
R1440:Dscam	UTSW	16	96819951	missense	probably damaging	1.00
R1442:Dscam	UTSW	16	96608074	missense	possibly damaging	0.94
R1464:Dscam	UTSW	16	96801253	missense	possibly damaging	0.94
R1464:Dscam	UTSW	16	96801253	missense	possibly damaging	0.94
R1478:Dscam	UTSW	16	96790910	missense	probably benign	0.15
R1530:Dscam	UTSW	16	96819874	missense	probably damaging	1.00
R1731:Dscam	UTSW	16	96819876	missense	probably damaging	1.00
R1765:Dscam	UTSW	16	96685379	missense	probably benign	0.00
R1824:Dscam	UTSW	16	96825581	missense	probably benign	0.00
R1933:Dscam	UTSW	16	96593214	missense	probably benign	0.00
R2005:Dscam	UTSW	16	97038920	missense	probably benign	0.02
R2006:Dscam	UTSW	16	96819912	missense	probably damaging	1.00
R2101:Dscam	UTSW	16	96610349	missense	probably benign	0.00
R2177:Dscam	UTSW	16	96610324	missense	probably damaging	0.98
R2342:Dscam	UTSW	16	96619502	missense	probably damaging	1.00
R2851:Dscam	UTSW	16	96622715	missense	possibly damaging	0.94
R2929:Dscam	UTSW	16	96685412	missense	possibly damaging	0.76
R3055:Dscam	UTSW	16	96801355	missense	probably damaging	1.00
R3157:Dscam	UTSW	16	96678510	missense	probably benign	0.16
R3159:Dscam	UTSW	16	96678510	missense	probably benign	0.16
R3944:Dscam	UTSW	16	96820997	missense	probably damaging	0.99
R4080:Dscam	UTSW	16	96683772	missense	probably benign	0.01
R4285:Dscam	UTSW	16	96709109	critical splice donor site	probably null
R4384:Dscam	UTSW	16	96709216	missense	probably damaging	0.99
R4460:Dscam	UTSW	16	96610319	missense	probably damaging	1.00
R4575:Dscam	UTSW	16	96825623	missense	possibly damaging	0.82
R4594:Dscam	UTSW	16	96717996	missense	possibly damaging	0.78
R4643:Dscam	UTSW	16	96685301	missense	probably damaging	0.96
R4698:Dscam	UTSW	16	96610324	missense	probably damaging	1.00
R4716:Dscam	UTSW	16	96619571	missense	possibly damaging	0.80
R4743:Dscam	UTSW	16	96830056	missense	probably benign	0.00
R4766:Dscam	UTSW	16	96643988	missense	probably benign	0.02
R4899:Dscam	UTSW	16	96683818	missense	probably benign	0.01
R4987:Dscam	UTSW	16	96697521	missense	probably benign	0.00
R4990:Dscam	UTSW	16	96825515	missense	probably benign	0.12
R5123:Dscam	UTSW	16	96772437	missense	probably damaging	1.00
R5130:Dscam	UTSW	16	96819779	missense	probably benign	0.00
R5328:Dscam	UTSW	16	96673678	missense	probably benign	0.33
R5666:Dscam	UTSW	16	96718164	missense	probably benign	0.23
R5670:Dscam	UTSW	16	96718164	missense	probably benign	0.23
R5678:Dscam	UTSW	16	96790900	missense	probably benign	0.16
R5827:Dscam	UTSW	16	96649991	critical splice donor site	probably null
R5907:Dscam	UTSW	16	96820920	missense	probably damaging	0.97
R6032:Dscam	UTSW	16	96649991	critical splice donor site	probably null
R6032:Dscam	UTSW	16	96649991	critical splice donor site	probably null
R6103:Dscam	UTSW	16	96825581	missense	probably benign
R6240:Dscam	UTSW	16	96619502	missense	probably damaging	1.00
R6257:Dscam	UTSW	16	96673714	missense	possibly damaging	0.94
R6361:Dscam	UTSW	16	96622811	missense	probably benign	0.08
R6405:Dscam	UTSW	16	96678425	missense	probably damaging	1.00
R6444:Dscam	UTSW	16	96619644	missense	probably damaging	1.00
R6560:Dscam	UTSW	16	96825735	missense	probably benign	0.00
R6598:Dscam	UTSW	16	96819784	missense	probably damaging	1.00
R6622:Dscam	UTSW	16	96645073	missense	probably benign	0.06
R6792:Dscam	UTSW	16	96593255	missense	probably damaging	0.96
R6792:Dscam	UTSW	16	96648237	missense	probably damaging	1.00
R6827:Dscam	UTSW	16	97038991	missense	probably damaging	1.00
R6868:Dscam	UTSW	16	96829940	missense	probably damaging	1.00
R6898:Dscam	UTSW	16	96829900	missense	probably benign	0.02
R6903:Dscam	UTSW	16	96820788	missense	probably damaging	1.00
R7051:Dscam	UTSW	16	96819786	missense	probably benign	0.01
R7146:Dscam	UTSW	16	96829917	nonsense	probably null
R7180:Dscam	UTSW	16	96825564	missense	probably damaging	0.97
R7209:Dscam	UTSW	16	96650344	splice site	probably null
R7247:Dscam	UTSW	16	96820808	missense	probably damaging	0.99
R7269:Dscam	UTSW	16	96678401	missense	probably benign	0.00
R7301:Dscam	UTSW	16	97056532	missense	probably benign	0.01
R7328:Dscam	UTSW	16	96645035	nonsense	probably null
R7368:Dscam	UTSW	16	96643931	missense	probably benign	0.00
R7425:Dscam	UTSW	16	96629398	missense	probably damaging	1.00
R7536:Dscam	UTSW	16	96641026	splice site	probably null
R7624:Dscam	UTSW	16	96610324	missense	probably damaging	1.00
R7766:Dscam	UTSW	16	96790901	missense	probably benign	0.31
R7817:Dscam	UTSW	16	96640864	missense	probably benign
R7843:Dscam	UTSW	16	96825630	missense	probably damaging	0.99
R7911:Dscam	UTSW	16	96643922	missense	probably benign	0.01
R8108:Dscam	UTSW	16	96643879	missense	probably benign	0.01
R8128:Dscam	UTSW	16	96801174	splice site	probably null
R8770:Dscam	UTSW	16	96654906	missense	possibly damaging	0.50
R8876:Dscam	UTSW	16	96619628	missense	probably damaging	0.96
R9005:Dscam	UTSW	16	96801380	missense	probably damaging	1.00
R9009:Dscam	UTSW	16	97038916	missense	probably benign	0.10
R9168:Dscam	UTSW	16	96619568	missense	possibly damaging	0.82
R9176:Dscam	UTSW	16	96685353	missense	probably benign	0.37
R9244:Dscam	UTSW	16	96685229	missense	possibly damaging	0.62
R9339:Dscam	UTSW	16	96716063	missense	possibly damaging	0.89
R9374:Dscam	UTSW	16	97056657	missense	probably benign	0.19
R9385:Dscam	UTSW	16	97039003	missense	probably benign
R9674:Dscam	UTSW	16	96640836	missense	probably benign	0.03
X0025:Dscam	UTSW	16	96709161	missense	probably damaging	1.00
Z1088:Dscam	UTSW	16	96772561	missense	probably benign	0.01
Z1177:Dscam	UTSW	16	96608189	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GGTCCCATCTTAAAAGCCAGG -3'
(R):5'- GTGTACCCATTTCTTTCCATGAGATG -3'

Sequencing Primer
(F):5'- CTTGGAAAGCAGCGGTGTG -3'
(R):5'- CATTTCTTTCCATGAGATGTACCC -3'

Posted On

2019-10-07