Incidental Mutation 'R7474:Vav1'
ID579379
Institutional Source Beutler Lab
Gene Symbol Vav1
Ensembl Gene ENSMUSG00000034116
Gene Namevav 1 oncogene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.447) question?
Stock #R7474 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location57279100-57328031 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57299102 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 242 (E242G)
Ref Sequence ENSEMBL: ENSMUSP00000005889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005889] [ENSMUST00000112870] [ENSMUST00000169220]
PDB Structure
NMR STRUCTURE OF THE Y174 AUTOINHIBITED DBL HOMOLOGY DOMAIN [SOLUTION NMR]
CRYSTAL STRUCTURE OF VAV SH3 DOMAIN [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF VAV AND GRB2 SH3 DOMAINS [X-RAY DIFFRACTION]
Solution structure of N-terminal SH3 domain mutant(P33G) of murine Vav [SOLUTION NMR]
Attachment of an NMR-invisible solubility enhancement tag (INSET) using a sortase-mediated protein ligation method [SOLUTION NMR]
CRITICAL STRUCTURAL ROLE FOR THE PH AND C1 DOMAINS OF THE VAV1 EXCHANGE FACTOR [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000005889
AA Change: E242G

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000005889
Gene: ENSMUSG00000034116
AA Change: E242G

DomainStartEndE-ValueType
CH 3 115 5.69e-15 SMART
RhoGEF 198 372 7.89e-62 SMART
PH 403 506 8.45e-12 SMART
C1 516 564 3.67e-9 SMART
SH3 595 659 1.65e-8 SMART
SH2 669 751 8.88e-25 SMART
SH3 785 841 1.44e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112870
AA Change: E242G

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000108491
Gene: ENSMUSG00000034116
AA Change: E242G

DomainStartEndE-ValueType
CH 3 115 5.69e-15 SMART
RhoGEF 198 372 7.89e-62 SMART
PH 403 506 8.45e-12 SMART
C1 516 564 3.67e-9 SMART
SH3 595 659 1.65e-8 SMART
SH2 633 712 3.93e-2 SMART
SH3 746 802 1.44e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169220
AA Change: E218G

PolyPhen 2 Score 0.142 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000126694
Gene: ENSMUSG00000034116
AA Change: E218G

DomainStartEndE-ValueType
Pfam:CAMSAP_CH 27 79 6.2e-11 PFAM
RhoGEF 174 348 7.89e-62 SMART
PH 379 482 8.45e-12 SMART
C1 492 540 3.67e-9 SMART
SH3 571 635 1.65e-8 SMART
SH2 645 727 8.88e-25 SMART
SH3 761 817 1.44e-22 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the VAV gene family. The VAV proteins are guanine nucleotide exchange factors (GEFs) for Rho family GTPases that activate pathways leading to actin cytoskeletal rearrangements and transcriptional alterations. The encoded protein is important in hematopoiesis, playing a role in T-cell and B-cell development and activation. The encoded protein has been identified as the specific binding partner of Nef proteins from HIV-1. Coexpression and binding of these partners initiates profound morphological changes, cytoskeletal rearrangements and the JNK/SAPK signaling cascade, leading to increased levels of viral transcription and replication. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygous null mutants exhibit defective T cell maturation, interleukin-2 production, and cell cycle progression. Immunoglobulin class switching is also impaired and attributed to defective T cell help. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,328,088 C3089* probably null Het
Abcc1 A G 16: 14,472,986 T1487A possibly damaging Het
Agfg1 T A 1: 82,882,411 L333* probably null Het
Agfg2 C A 5: 137,653,868 V410F possibly damaging Het
Amotl2 T C 9: 102,730,111 V706A probably benign Het
Apob A T 12: 8,009,185 T2556S probably benign Het
Asb18 T A 1: 89,993,033 H174L possibly damaging Het
Atp10a G A 7: 58,658,527 E25K unknown Het
Aup1 T C 6: 83,054,967 L65P probably benign Het
Blvra T C 2: 127,086,849 F86L probably damaging Het
Cabp4 T C 19: 4,139,399 D53G probably benign Het
Cd300c2 T A 11: 114,998,296 E153V probably benign Het
Crxos A G 7: 15,902,931 E143G possibly damaging Het
Csmd2 A G 4: 128,546,127 N3125D Het
Cyp2c67 T A 19: 39,617,432 Q340L probably null Het
Dscam T A 16: 96,819,889 N540Y possibly damaging Het
E2f8 G A 7: 48,875,760 R155W probably damaging Het
Ext1 A T 15: 53,344,489 V292D probably damaging Het
Extl3 T C 14: 65,076,641 E364G possibly damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Fsd1 A T 17: 55,988,149 D46V possibly damaging Het
Gcnt2 T A 13: 40,958,257 L374H probably damaging Het
Gm10309 G A 17: 86,504,667 probably benign Het
Gm13084 T C 4: 143,811,699 D234G probably benign Het
Gm14410 A T 2: 177,202,825 probably null Het
Gm5114 A T 7: 39,407,980 S738R probably benign Het
Gtf3c2 C A 5: 31,167,756 G502W probably damaging Het
Insc G A 7: 114,768,823 probably null Het
Kcnt2 T C 1: 140,570,478 Y898H possibly damaging Het
Kctd19 C A 8: 105,392,032 R299L probably benign Het
Klf10 T C 15: 38,297,202 N198S probably benign Het
L3mbtl1 A T 2: 162,966,604 D574V probably damaging Het
Lamc1 G A 1: 153,332,265 A92V possibly damaging Het
Lrrc63 T A 14: 75,126,203 T163S possibly damaging Het
Mak T A 13: 41,051,480 K127N probably damaging Het
Mdga2 G A 12: 66,486,761 Q945* probably null Het
Mthfr T A 4: 148,052,602 I519N possibly damaging Het
Mtmr2 C A 9: 13,799,225 H357N probably damaging Het
Myh13 A T 11: 67,327,164 E21V possibly damaging Het
Myh13 A C 11: 67,367,711 Q184P Het
Nans T A 4: 46,502,484 L307Q probably damaging Het
Ncan C A 8: 70,102,041 R1042L possibly damaging Het
Nrg3 T C 14: 39,011,999 E310G probably damaging Het
Obsl1 A C 1: 75,498,184 N857K probably benign Het
Olfml2a T C 2: 38,960,261 V663A probably damaging Het
Olfr1104 T C 2: 87,022,554 probably benign Het
Olfr116 T C 17: 37,624,386 D83G probably benign Het
Olfr213 G T 6: 116,541,038 C195F probably damaging Het
Olfr603 A G 7: 103,383,762 I80T probably damaging Het
Olfr621-ps1 C A 7: 103,629,147 W271L unknown Het
Pla2g4a T C 1: 149,865,200 M363V possibly damaging Het
Prickle1 A T 15: 93,508,671 V157D possibly damaging Het
Pstk A G 7: 131,373,633 N105S probably benign Het
Ptpn21 A G 12: 98,737,363 probably null Het
Rnf2 T A 1: 151,471,716 E277D probably benign Het
Rnpepl1 T C 1: 92,918,972 F532S probably benign Het
Rtn1 C T 12: 72,308,390 A261T possibly damaging Het
Ryr2 A G 13: 11,594,876 S4355P probably benign Het
Sacs T G 14: 61,211,178 L3558V probably benign Het
Senp6 T C 9: 80,142,328 V1047A probably damaging Het
Slco2b1 A T 7: 99,664,832 C515S probably damaging Het
Smgc T A 15: 91,860,694 V732E possibly damaging Het
Sorcs1 T C 19: 50,153,112 M1105V possibly damaging Het
Spats1 A G 17: 45,457,161 Y160H possibly damaging Het
Tnfsf14 T A 17: 57,190,848 D128V Het
Tns3 T C 11: 8,530,894 Q234R probably damaging Het
Uxs1 A G 1: 43,757,024 V306A possibly damaging Het
Vac14 T A 8: 110,636,434 V304D probably damaging Het
Vangl1 A G 3: 102,184,249 F174L probably benign Het
Vsir A G 10: 60,368,922 N305D probably benign Het
Vwce T A 19: 10,646,941 C399S possibly damaging Het
Wrn A T 8: 33,329,181 L248M probably damaging Het
Zfp141 T A 7: 42,476,254 K265* probably null Het
Zfp735 A T 11: 73,711,176 K315N possibly damaging Het
Other mutations in Vav1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Vav1 APN 17 57299176 missense probably benign 0.21
IGL01613:Vav1 APN 17 57307067 missense possibly damaging 0.93
IGL02032:Vav1 APN 17 57297090 missense possibly damaging 0.91
IGL02213:Vav1 APN 17 57305351 missense possibly damaging 0.84
IGL03009:Vav1 APN 17 57296582 missense probably benign 0.38
Belated UTSW 17 57301214 missense probably benign 0.06
Delayed UTSW 17 57296552 missense probably damaging 1.00
finally UTSW 17 57311860 nonsense probably null
Last UTSW 17 57296039 missense probably damaging 0.99
Late UTSW 17 57301870 missense possibly damaging 0.91
Plain_sight UTSW 17 57297122 missense probably damaging 1.00
tardive UTSW 17 57303079 nonsense probably null
R0116:Vav1 UTSW 17 57296039 missense probably damaging 0.99
R0125:Vav1 UTSW 17 57299847 missense probably damaging 1.00
R0268:Vav1 UTSW 17 57296090 missense probably damaging 1.00
R0344:Vav1 UTSW 17 57296090 missense probably damaging 1.00
R0579:Vav1 UTSW 17 57279271 missense probably benign 0.01
R0634:Vav1 UTSW 17 57303862 missense probably benign 0.00
R1313:Vav1 UTSW 17 57309498 splice site probably benign
R1345:Vav1 UTSW 17 57301214 missense probably benign 0.06
R1402:Vav1 UTSW 17 57303849 missense probably benign 0.18
R1402:Vav1 UTSW 17 57303849 missense probably benign 0.18
R1579:Vav1 UTSW 17 57297252 missense probably benign 0.05
R1872:Vav1 UTSW 17 57324750 missense probably damaging 1.00
R1971:Vav1 UTSW 17 57327697 missense probably damaging 1.00
R2197:Vav1 UTSW 17 57303140 missense probably benign 0.37
R2903:Vav1 UTSW 17 57306187 missense probably benign 0.05
R4623:Vav1 UTSW 17 57299839 splice site probably null
R4753:Vav1 UTSW 17 57306140 missense probably damaging 0.98
R4779:Vav1 UTSW 17 57296552 missense probably damaging 1.00
R5232:Vav1 UTSW 17 57303846 missense possibly damaging 0.81
R5240:Vav1 UTSW 17 57297122 missense probably damaging 1.00
R5503:Vav1 UTSW 17 57303079 nonsense probably null
R5592:Vav1 UTSW 17 57304835 missense probably benign 0.00
R5782:Vav1 UTSW 17 57296001 missense probably damaging 1.00
R5945:Vav1 UTSW 17 57301870 missense possibly damaging 0.91
R6113:Vav1 UTSW 17 57301884 missense probably benign 0.00
R6514:Vav1 UTSW 17 57327660 missense probably damaging 1.00
R6575:Vav1 UTSW 17 57305280 missense probably damaging 0.97
R6932:Vav1 UTSW 17 57302330 missense possibly damaging 0.92
R7024:Vav1 UTSW 17 57279268 missense probably damaging 1.00
R7063:Vav1 UTSW 17 57311860 nonsense probably null
R7322:Vav1 UTSW 17 57302266 missense probably benign
R7335:Vav1 UTSW 17 57296720 missense probably benign
R7665:Vav1 UTSW 17 57297086 missense probably damaging 1.00
Z1176:Vav1 UTSW 17 57303853 missense probably damaging 1.00
Z1177:Vav1 UTSW 17 57303040 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- CTTTTCCAAGGGGATTTGTGAC -3'
(R):5'- AATGAAGAACCCTGCCCAGTAG -3'

Sequencing Primer
(F):5'- GGGACATGTGTATGACCTCCTC -3'
(R):5'- GAACCCTGCCCAGTAGTCTCTAATG -3'
Posted On2019-10-07