Incidental Mutation 'R7475:Stard9'
ID 579393
Institutional Source Beutler Lab
Gene Symbol Stard9
Ensembl Gene ENSMUSG00000033705
Gene Name StAR related lipid transfer domain containing 9
Synonyms 4831403C07Rik, E230025N21Rik, Kif16a, N-3 kinesin
MMRRC Submission 045549-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.173) question?
Stock # R7475 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 120459602-120562376 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 120518591 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 505 (D505G)
Ref Sequence ENSEMBL: ENSMUSP00000136055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000140843] [ENSMUST00000180041]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000140843
SMART Domains Protein: ENSMUSP00000117178
Gene: ENSMUSG00000033705

DomainStartEndE-ValueType
FHA 63 115 2.8e-4 SMART
coiled coil region 334 354 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
low complexity region 866 871 N/A INTRINSIC
low complexity region 1023 1035 N/A INTRINSIC
low complexity region 1234 1248 N/A INTRINSIC
low complexity region 1765 1775 N/A INTRINSIC
low complexity region 2546 2559 N/A INTRINSIC
low complexity region 2953 2963 N/A INTRINSIC
low complexity region 3269 3281 N/A INTRINSIC
low complexity region 3421 3435 N/A INTRINSIC
coiled coil region 3767 3808 N/A INTRINSIC
low complexity region 3812 3821 N/A INTRINSIC
low complexity region 3827 3844 N/A INTRINSIC
low complexity region 3904 3925 N/A INTRINSIC
SCOP:d1jssa_ 3946 4142 1e-28 SMART
Blast:START 3947 4143 1e-10 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000180041
AA Change: D505G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136055
Gene: ENSMUSG00000033705
AA Change: D505G

DomainStartEndE-ValueType
KISc 1 392 3.31e-143 SMART
low complexity region 398 409 N/A INTRINSIC
FHA 481 533 2.8e-4 SMART
coiled coil region 752 772 N/A INTRINSIC
low complexity region 991 1002 N/A INTRINSIC
low complexity region 1284 1289 N/A INTRINSIC
low complexity region 1441 1453 N/A INTRINSIC
low complexity region 1652 1666 N/A INTRINSIC
low complexity region 2183 2193 N/A INTRINSIC
low complexity region 2964 2977 N/A INTRINSIC
low complexity region 3371 3381 N/A INTRINSIC
low complexity region 3687 3699 N/A INTRINSIC
low complexity region 3839 3853 N/A INTRINSIC
coiled coil region 4185 4226 N/A INTRINSIC
low complexity region 4230 4239 N/A INTRINSIC
low complexity region 4245 4262 N/A INTRINSIC
low complexity region 4322 4343 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G T 16: 20,218,739 (GRCm39) N214K probably benign Het
Abcf1 A G 17: 36,274,459 (GRCm39) probably null Het
Agxt2 A T 15: 10,409,623 (GRCm39) M508L probably benign Het
Akr1c21 A T 13: 4,626,318 (GRCm39) Y114F probably benign Het
Amz1 T C 5: 140,729,941 (GRCm39) probably null Het
Ank1 G T 8: 23,622,646 (GRCm39) A1732S probably benign Het
Atg16l1 T C 1: 87,687,805 (GRCm39) S50P possibly damaging Het
AW551984 A G 9: 39,509,236 (GRCm39) S302P probably damaging Het
Ccn6 T A 10: 39,034,296 (GRCm39) Y102F probably damaging Het
Ces3a T A 8: 105,780,322 (GRCm39) probably null Het
Dedd C A 1: 171,167,881 (GRCm39) P185Q probably benign Het
Fam186a A T 15: 99,845,395 (GRCm39) V283E unknown Het
Fat2 C A 11: 55,194,479 (GRCm39) V1187F probably benign Het
Fbxw11 T C 11: 32,661,999 (GRCm39) probably null Het
Fcgbp C T 7: 27,802,401 (GRCm39) T1443I probably damaging Het
Foxj2 A G 6: 122,814,801 (GRCm39) D279G probably benign Het
Gbp5 A G 3: 142,207,122 (GRCm39) D97G probably damaging Het
Gm49368 A T 7: 127,707,154 (GRCm39) T661S possibly damaging Het
Gria4 T G 9: 4,513,330 (GRCm39) T260P probably damaging Het
Gtf2ird2 T A 5: 134,230,267 (GRCm39) D195E possibly damaging Het
Hectd4 T A 5: 121,496,196 (GRCm39) probably null Het
Ifngr2 G A 16: 91,354,797 (GRCm39) C32Y unknown Het
Ikzf5 A T 7: 130,993,788 (GRCm39) C280S probably benign Het
Ints9 G T 14: 65,263,914 (GRCm39) E395D probably null Het
Isoc2b T C 7: 4,854,084 (GRCm39) D96G probably benign Het
Jmjd1c T G 10: 67,061,092 (GRCm39) S967R probably benign Het
Kcnj3 A T 2: 55,327,338 (GRCm39) K42N probably benign Het
Kiz T C 2: 146,733,006 (GRCm39) V394A possibly damaging Het
Knl1 A T 2: 118,918,027 (GRCm39) H1795L probably damaging Het
Lmntd2 A G 7: 140,790,602 (GRCm39) probably null Het
Loxhd1 C A 18: 77,500,001 (GRCm39) D1690E possibly damaging Het
Lrp1b T C 2: 41,234,588 (GRCm39) D1121G Het
Map3k2 T C 18: 32,333,015 (GRCm39) V63A possibly damaging Het
Mcc G T 18: 44,609,303 (GRCm39) A499D probably damaging Het
Mcpt9 T A 14: 56,264,400 (GRCm39) I232F probably damaging Het
Meltf A G 16: 31,700,756 (GRCm39) K92R probably benign Het
Mff T A 1: 82,723,159 (GRCm39) probably null Het
Mrgpra3 T A 7: 47,239,695 (GRCm39) Y77F probably damaging Het
Mylk G A 16: 34,734,446 (GRCm39) probably null Het
Ndufv2 A G 17: 66,394,532 (GRCm39) V111A possibly damaging Het
Nkd2 T C 13: 73,973,861 (GRCm39) E99G probably damaging Het
Nlk C A 11: 78,474,225 (GRCm39) G358V probably damaging Het
Nnmt A T 9: 48,503,532 (GRCm39) C165S probably damaging Het
Nxpe4 T A 9: 48,304,640 (GRCm39) C242* probably null Het
Oas1b A T 5: 120,955,705 (GRCm39) N162I probably damaging Het
Or4s2 A G 2: 88,473,554 (GRCm39) I148V probably benign Het
Otog A G 7: 45,916,700 (GRCm39) N879S probably damaging Het
Pcsk7 T A 9: 45,838,923 (GRCm39) Y612N probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Pgbd5 T C 8: 125,160,750 (GRCm39) D39G probably benign Het
Pkhd1l1 C T 15: 44,368,581 (GRCm39) Q800* probably null Het
Pkn3 T C 2: 29,977,122 (GRCm39) S621P probably benign Het
Polr3c T C 3: 96,622,501 (GRCm39) I385V probably benign Het
Ppp1r21 G T 17: 88,863,031 (GRCm39) G257W probably benign Het
Prkn A G 17: 11,653,501 (GRCm39) D199G probably benign Het
Pxylp1 C T 9: 96,738,420 (GRCm39) probably null Het
Rasgrp1 T C 2: 117,116,589 (GRCm39) T613A probably benign Het
Robo3 C T 9: 37,336,674 (GRCm39) V387I probably benign Het
Rxfp2 T A 5: 149,973,046 (GRCm39) Y174N possibly damaging Het
Sec24a T C 11: 51,604,379 (GRCm39) M746V probably damaging Het
Sema4f T A 6: 82,891,355 (GRCm39) E571D possibly damaging Het
Septin3 T C 15: 82,170,657 (GRCm39) V217A probably benign Het
Serpinb1b A C 13: 33,277,548 (GRCm39) K260N probably benign Het
Sin3b A G 8: 73,476,500 (GRCm39) T645A possibly damaging Het
Sobp C T 10: 42,897,830 (GRCm39) R585Q probably damaging Het
Specc1l T A 10: 75,082,281 (GRCm39) L559Q possibly damaging Het
Srxn1 C T 2: 151,947,573 (GRCm39) probably benign Het
Sspo G A 6: 48,432,794 (GRCm39) R890Q probably benign Het
Tjp1 A T 7: 64,972,087 (GRCm39) I653K probably damaging Het
Tnks C T 8: 35,298,866 (GRCm39) E1296K probably damaging Het
Ttbk2 A T 2: 120,579,121 (GRCm39) I667N probably benign Het
Usp24 T C 4: 106,199,550 (GRCm39) S165P possibly damaging Het
Usp46 T A 5: 74,189,598 (GRCm39) K109* probably null Het
Vmn1r191 A G 13: 22,362,942 (GRCm39) C271R probably benign Het
Zfp592 T C 7: 80,673,200 (GRCm39) S55P probably damaging Het
Zmynd15 T C 11: 70,351,867 (GRCm39) S158P probably benign Het
Zscan22 T G 7: 12,640,664 (GRCm39) C303G probably damaging Het
Other mutations in Stard9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Stard9 APN 2 120,532,328 (GRCm39) missense possibly damaging 0.52
IGL01122:Stard9 APN 2 120,528,960 (GRCm39) missense possibly damaging 0.93
IGL01318:Stard9 APN 2 120,529,200 (GRCm39) missense possibly damaging 0.56
IGL01371:Stard9 APN 2 120,531,849 (GRCm39) missense probably benign 0.04
IGL01394:Stard9 APN 2 120,536,808 (GRCm39) missense possibly damaging 0.78
IGL01531:Stard9 APN 2 120,504,085 (GRCm39) missense possibly damaging 0.93
IGL01721:Stard9 APN 2 120,533,811 (GRCm39) missense probably damaging 1.00
IGL01810:Stard9 APN 2 120,529,565 (GRCm39) missense possibly damaging 0.95
IGL01829:Stard9 APN 2 120,536,927 (GRCm39) missense possibly damaging 0.59
IGL01916:Stard9 APN 2 120,498,497 (GRCm39) missense probably damaging 1.00
IGL02031:Stard9 APN 2 120,532,820 (GRCm39) missense probably benign 0.27
IGL02081:Stard9 APN 2 120,495,391 (GRCm39) missense probably damaging 0.98
IGL02558:Stard9 APN 2 120,527,388 (GRCm39) missense possibly damaging 0.95
IGL02646:Stard9 APN 2 120,529,473 (GRCm39) missense probably damaging 1.00
IGL02873:Stard9 APN 2 120,544,288 (GRCm39) missense probably damaging 1.00
IGL03195:Stard9 APN 2 120,536,283 (GRCm39) missense probably damaging 1.00
IGL03204:Stard9 APN 2 120,536,283 (GRCm39) missense probably damaging 1.00
FR4737:Stard9 UTSW 2 120,526,566 (GRCm39) small insertion probably benign
IGL03014:Stard9 UTSW 2 120,532,675 (GRCm39) unclassified probably benign
PIT4151001:Stard9 UTSW 2 120,533,237 (GRCm39) nonsense probably null
PIT4498001:Stard9 UTSW 2 120,527,916 (GRCm39) missense possibly damaging 0.86
R0027:Stard9 UTSW 2 120,533,982 (GRCm39) missense probably benign
R0027:Stard9 UTSW 2 120,533,982 (GRCm39) missense probably benign
R0038:Stard9 UTSW 2 120,526,313 (GRCm39) missense probably benign
R0049:Stard9 UTSW 2 120,530,300 (GRCm39) missense probably damaging 1.00
R0049:Stard9 UTSW 2 120,530,300 (GRCm39) missense probably damaging 1.00
R0116:Stard9 UTSW 2 120,464,736 (GRCm39) missense probably damaging 0.99
R0398:Stard9 UTSW 2 120,526,788 (GRCm39) missense probably benign 0.03
R0479:Stard9 UTSW 2 120,528,077 (GRCm39) missense probably damaging 1.00
R0556:Stard9 UTSW 2 120,529,404 (GRCm39) missense probably benign 0.09
R0589:Stard9 UTSW 2 120,529,028 (GRCm39) missense probably benign 0.00
R0609:Stard9 UTSW 2 120,536,787 (GRCm39) missense probably damaging 1.00
R0611:Stard9 UTSW 2 120,529,738 (GRCm39) missense probably benign 0.00
R0683:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R0751:Stard9 UTSW 2 120,527,966 (GRCm39) missense probably benign 0.04
R0833:Stard9 UTSW 2 120,527,480 (GRCm39) missense possibly damaging 0.86
R0836:Stard9 UTSW 2 120,527,480 (GRCm39) missense possibly damaging 0.86
R0838:Stard9 UTSW 2 120,531,323 (GRCm39) missense probably damaging 1.00
R0848:Stard9 UTSW 2 120,526,304 (GRCm39) missense probably damaging 1.00
R0849:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R0961:Stard9 UTSW 2 120,523,920 (GRCm39) missense probably benign 0.01
R0993:Stard9 UTSW 2 120,535,650 (GRCm39) missense probably damaging 1.00
R1005:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1006:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1115:Stard9 UTSW 2 120,523,331 (GRCm39) missense probably benign 0.05
R1163:Stard9 UTSW 2 120,526,694 (GRCm39) missense possibly damaging 0.86
R1199:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1200:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1331:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1332:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1333:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1334:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1335:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1336:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1338:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1346:Stard9 UTSW 2 120,543,929 (GRCm39) missense probably damaging 1.00
R1370:Stard9 UTSW 2 120,527,958 (GRCm39) missense probably benign 0.11
R1384:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1401:Stard9 UTSW 2 120,543,328 (GRCm39) splice site probably benign
R1416:Stard9 UTSW 2 120,531,453 (GRCm39) missense probably benign 0.00
R1453:Stard9 UTSW 2 120,496,857 (GRCm39) missense probably damaging 1.00
R1468:Stard9 UTSW 2 120,533,678 (GRCm39) missense possibly damaging 0.90
R1468:Stard9 UTSW 2 120,533,678 (GRCm39) missense possibly damaging 0.90
R1525:Stard9 UTSW 2 120,532,533 (GRCm39) missense probably benign 0.09
R1538:Stard9 UTSW 2 120,527,192 (GRCm39) missense probably benign 0.25
R1614:Stard9 UTSW 2 120,528,156 (GRCm39) missense possibly damaging 0.95
R1654:Stard9 UTSW 2 120,534,203 (GRCm39) missense probably benign 0.37
R1658:Stard9 UTSW 2 120,532,023 (GRCm39) missense probably benign 0.02
R1686:Stard9 UTSW 2 120,529,973 (GRCm39) missense probably benign 0.00
R1797:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1803:Stard9 UTSW 2 120,531,970 (GRCm39) missense probably benign 0.24
R1806:Stard9 UTSW 2 120,509,934 (GRCm39) splice site probably null
R1847:Stard9 UTSW 2 120,528,970 (GRCm39) missense possibly damaging 0.51
R1853:Stard9 UTSW 2 120,519,232 (GRCm39) missense probably damaging 1.00
R1892:Stard9 UTSW 2 120,524,189 (GRCm39) missense probably benign 0.01
R1906:Stard9 UTSW 2 120,526,908 (GRCm39) missense probably benign 0.00
R1907:Stard9 UTSW 2 120,544,293 (GRCm39) missense probably damaging 1.00
R1930:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1933:Stard9 UTSW 2 120,529,137 (GRCm39) missense possibly damaging 0.55
R1989:Stard9 UTSW 2 120,531,887 (GRCm39) missense probably benign
R1999:Stard9 UTSW 2 120,523,349 (GRCm39) missense probably damaging 0.99
R2004:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R2005:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R2005:Stard9 UTSW 2 120,495,426 (GRCm39) missense possibly damaging 0.90
R2021:Stard9 UTSW 2 120,534,716 (GRCm39) missense probably benign 0.05
R2025:Stard9 UTSW 2 120,532,879 (GRCm39) missense probably benign 0.20
R2190:Stard9 UTSW 2 120,544,601 (GRCm39) missense probably benign 0.22
R2204:Stard9 UTSW 2 120,529,012 (GRCm39) frame shift probably null
R2422:Stard9 UTSW 2 120,530,765 (GRCm39) missense probably benign 0.29
R3401:Stard9 UTSW 2 120,534,170 (GRCm39) missense probably damaging 0.98
R3618:Stard9 UTSW 2 120,529,500 (GRCm39) missense possibly damaging 0.49
R3619:Stard9 UTSW 2 120,529,500 (GRCm39) missense possibly damaging 0.49
R3900:Stard9 UTSW 2 120,544,030 (GRCm39) missense possibly damaging 0.93
R3943:Stard9 UTSW 2 120,528,710 (GRCm39) missense probably benign 0.11
R4022:Stard9 UTSW 2 120,534,636 (GRCm39) missense probably benign 0.05
R4223:Stard9 UTSW 2 120,495,472 (GRCm39) missense possibly damaging 0.95
R4224:Stard9 UTSW 2 120,495,472 (GRCm39) missense possibly damaging 0.95
R4225:Stard9 UTSW 2 120,495,472 (GRCm39) missense possibly damaging 0.95
R4345:Stard9 UTSW 2 120,532,427 (GRCm39) missense probably benign 0.43
R4382:Stard9 UTSW 2 120,464,703 (GRCm39) missense probably damaging 1.00
R4453:Stard9 UTSW 2 120,528,272 (GRCm39) missense probably benign
R4499:Stard9 UTSW 2 120,530,722 (GRCm39) missense probably benign 0.05
R4524:Stard9 UTSW 2 120,526,926 (GRCm39) missense probably damaging 1.00
R4671:Stard9 UTSW 2 120,529,121 (GRCm39) missense probably damaging 0.98
R4701:Stard9 UTSW 2 120,536,194 (GRCm39) missense possibly damaging 0.85
R4744:Stard9 UTSW 2 120,526,604 (GRCm39) missense probably benign 0.01
R4822:Stard9 UTSW 2 120,526,422 (GRCm39) missense possibly damaging 0.94
R4847:Stard9 UTSW 2 120,533,594 (GRCm39) missense probably benign 0.18
R4863:Stard9 UTSW 2 120,531,341 (GRCm39) missense probably benign 0.00
R4898:Stard9 UTSW 2 120,536,900 (GRCm39) nonsense probably null
R5033:Stard9 UTSW 2 120,523,880 (GRCm39) missense probably benign 0.00
R5087:Stard9 UTSW 2 120,527,500 (GRCm39) nonsense probably null
R5157:Stard9 UTSW 2 120,528,342 (GRCm39) missense probably benign
R5213:Stard9 UTSW 2 120,529,707 (GRCm39) missense probably damaging 1.00
R5237:Stard9 UTSW 2 120,529,839 (GRCm39) missense probably damaging 0.96
R5257:Stard9 UTSW 2 120,529,824 (GRCm39) missense probably damaging 0.99
R5258:Stard9 UTSW 2 120,529,824 (GRCm39) missense probably damaging 0.99
R5273:Stard9 UTSW 2 120,535,568 (GRCm39) missense possibly damaging 0.94
R5286:Stard9 UTSW 2 120,532,428 (GRCm39) missense probably benign 0.43
R5288:Stard9 UTSW 2 120,531,111 (GRCm39) missense probably damaging 0.98
R5292:Stard9 UTSW 2 120,529,626 (GRCm39) missense probably benign 0.17
R5328:Stard9 UTSW 2 120,529,711 (GRCm39) missense probably damaging 1.00
R5385:Stard9 UTSW 2 120,531,111 (GRCm39) missense probably damaging 0.98
R5386:Stard9 UTSW 2 120,531,111 (GRCm39) missense probably damaging 0.98
R5393:Stard9 UTSW 2 120,533,387 (GRCm39) missense possibly damaging 0.87
R5405:Stard9 UTSW 2 120,524,149 (GRCm39) missense probably benign 0.17
R5685:Stard9 UTSW 2 120,535,803 (GRCm39) missense probably damaging 1.00
R5749:Stard9 UTSW 2 120,534,267 (GRCm39) missense probably damaging 1.00
R5780:Stard9 UTSW 2 120,533,877 (GRCm39) missense probably benign 0.02
R5901:Stard9 UTSW 2 120,531,851 (GRCm39) missense probably damaging 1.00
R5941:Stard9 UTSW 2 120,544,039 (GRCm39) missense probably damaging 1.00
R5960:Stard9 UTSW 2 120,530,442 (GRCm39) missense probably benign 0.05
R5966:Stard9 UTSW 2 120,527,580 (GRCm39) missense probably damaging 1.00
R5967:Stard9 UTSW 2 120,537,375 (GRCm39) missense probably damaging 0.99
R6012:Stard9 UTSW 2 120,535,067 (GRCm39) missense probably damaging 1.00
R6019:Stard9 UTSW 2 120,524,196 (GRCm39) frame shift probably null
R6020:Stard9 UTSW 2 120,524,196 (GRCm39) frame shift probably null
R6036:Stard9 UTSW 2 120,530,556 (GRCm39) missense probably benign 0.09
R6036:Stard9 UTSW 2 120,530,556 (GRCm39) missense probably benign 0.09
R6090:Stard9 UTSW 2 120,524,135 (GRCm39) missense probably damaging 0.99
R6192:Stard9 UTSW 2 120,527,241 (GRCm39) missense probably damaging 0.99
R6228:Stard9 UTSW 2 120,544,231 (GRCm39) missense probably damaging 1.00
R6235:Stard9 UTSW 2 120,544,027 (GRCm39) missense probably damaging 1.00
R6280:Stard9 UTSW 2 120,531,608 (GRCm39) missense probably benign
R6338:Stard9 UTSW 2 120,527,966 (GRCm39) missense probably benign
R6344:Stard9 UTSW 2 120,534,801 (GRCm39) missense probably benign 0.12
R6364:Stard9 UTSW 2 120,543,910 (GRCm39) missense probably damaging 1.00
R6383:Stard9 UTSW 2 120,496,888 (GRCm39) critical splice donor site probably null
R6644:Stard9 UTSW 2 120,526,253 (GRCm39) missense probably benign 0.11
R6747:Stard9 UTSW 2 120,528,864 (GRCm39) missense possibly damaging 0.62
R6833:Stard9 UTSW 2 120,531,740 (GRCm39) missense probably damaging 1.00
R6836:Stard9 UTSW 2 120,530,324 (GRCm39) missense probably benign 0.15
R6861:Stard9 UTSW 2 120,535,667 (GRCm39) missense probably benign 0.09
R6872:Stard9 UTSW 2 120,544,549 (GRCm39) nonsense probably null
R6875:Stard9 UTSW 2 120,527,917 (GRCm39) missense probably benign 0.04
R6915:Stard9 UTSW 2 120,533,111 (GRCm39) missense probably benign 0.00
R6934:Stard9 UTSW 2 120,528,176 (GRCm39) missense probably benign 0.00
R6943:Stard9 UTSW 2 120,532,677 (GRCm39) missense probably benign 0.29
R7009:Stard9 UTSW 2 120,527,672 (GRCm39) missense probably benign 0.37
R7031:Stard9 UTSW 2 120,530,931 (GRCm39) missense possibly damaging 0.61
R7132:Stard9 UTSW 2 120,509,859 (GRCm39) nonsense probably null
R7151:Stard9 UTSW 2 120,526,623 (GRCm39) missense probably benign
R7154:Stard9 UTSW 2 120,535,023 (GRCm39) missense probably benign 0.02
R7154:Stard9 UTSW 2 120,531,795 (GRCm39) missense probably benign 0.00
R7165:Stard9 UTSW 2 120,534,639 (GRCm39) missense probably damaging 1.00
R7260:Stard9 UTSW 2 120,537,419 (GRCm39) missense possibly damaging 0.90
R7270:Stard9 UTSW 2 120,464,755 (GRCm39) nonsense probably null
R7282:Stard9 UTSW 2 120,528,984 (GRCm39) missense probably benign 0.00
R7344:Stard9 UTSW 2 120,535,167 (GRCm39) missense possibly damaging 0.90
R7347:Stard9 UTSW 2 120,497,015 (GRCm39) missense probably benign
R7359:Stard9 UTSW 2 120,528,761 (GRCm39) missense probably damaging 1.00
R7375:Stard9 UTSW 2 120,495,483 (GRCm39) splice site probably null
R7410:Stard9 UTSW 2 120,531,978 (GRCm39) missense probably benign 0.41
R7422:Stard9 UTSW 2 120,532,633 (GRCm39) missense probably benign 0.21
R7523:Stard9 UTSW 2 120,530,078 (GRCm39) missense probably benign
R7553:Stard9 UTSW 2 120,524,289 (GRCm39) splice site probably null
R7624:Stard9 UTSW 2 120,518,627 (GRCm39) missense probably benign 0.15
R7761:Stard9 UTSW 2 120,529,860 (GRCm39) missense probably benign 0.00
R7794:Stard9 UTSW 2 120,534,911 (GRCm39) missense probably benign 0.01
R7819:Stard9 UTSW 2 120,531,465 (GRCm39) missense probably damaging 1.00
R7823:Stard9 UTSW 2 120,532,587 (GRCm39) missense probably damaging 0.96
R7837:Stard9 UTSW 2 120,534,146 (GRCm39) missense probably benign 0.06
R7889:Stard9 UTSW 2 120,534,942 (GRCm39) missense probably benign 0.11
R7905:Stard9 UTSW 2 120,526,562 (GRCm39) missense not run
R7956:Stard9 UTSW 2 120,535,852 (GRCm39) nonsense probably null
R8013:Stard9 UTSW 2 120,518,582 (GRCm39) missense probably damaging 1.00
R8113:Stard9 UTSW 2 120,534,911 (GRCm39) missense probably benign 0.01
R8114:Stard9 UTSW 2 120,534,911 (GRCm39) missense probably benign 0.01
R8116:Stard9 UTSW 2 120,495,420 (GRCm39) nonsense probably null
R8117:Stard9 UTSW 2 120,534,911 (GRCm39) missense probably benign 0.01
R8118:Stard9 UTSW 2 120,534,911 (GRCm39) missense probably benign 0.01
R8170:Stard9 UTSW 2 120,530,529 (GRCm39) missense possibly damaging 0.76
R8300:Stard9 UTSW 2 120,535,250 (GRCm39) missense possibly damaging 0.71
R8333:Stard9 UTSW 2 120,532,270 (GRCm39) missense probably benign 0.00
R8337:Stard9 UTSW 2 120,510,306 (GRCm39) missense probably damaging 1.00
R8536:Stard9 UTSW 2 120,545,140 (GRCm39) missense possibly damaging 0.93
R8682:Stard9 UTSW 2 120,533,796 (GRCm39) missense possibly damaging 0.65
R8696:Stard9 UTSW 2 120,531,595 (GRCm39) missense probably benign 0.02
R8708:Stard9 UTSW 2 120,534,059 (GRCm39) missense probably damaging 1.00
R8732:Stard9 UTSW 2 120,510,442 (GRCm39) missense probably damaging 1.00
R8798:Stard9 UTSW 2 120,535,212 (GRCm39) missense probably benign 0.09
R8807:Stard9 UTSW 2 120,535,932 (GRCm39) missense probably damaging 1.00
R8807:Stard9 UTSW 2 120,535,943 (GRCm39) missense probably damaging 1.00
R8862:Stard9 UTSW 2 120,534,099 (GRCm39) missense probably benign
R8920:Stard9 UTSW 2 120,533,088 (GRCm39) missense probably damaging 0.96
R9026:Stard9 UTSW 2 120,536,283 (GRCm39) missense probably damaging 1.00
R9048:Stard9 UTSW 2 120,508,415 (GRCm39) missense probably damaging 0.99
R9049:Stard9 UTSW 2 120,510,418 (GRCm39) missense probably benign 0.30
R9152:Stard9 UTSW 2 120,529,068 (GRCm39) missense probably damaging 0.99
R9189:Stard9 UTSW 2 120,533,500 (GRCm39) missense possibly damaging 0.95
R9238:Stard9 UTSW 2 120,528,447 (GRCm39) missense probably damaging 1.00
R9372:Stard9 UTSW 2 120,495,420 (GRCm39) nonsense probably null
R9393:Stard9 UTSW 2 120,518,656 (GRCm39) missense possibly damaging 0.88
R9444:Stard9 UTSW 2 120,495,414 (GRCm39) missense probably damaging 1.00
R9514:Stard9 UTSW 2 120,534,564 (GRCm39) missense probably damaging 1.00
R9515:Stard9 UTSW 2 120,534,564 (GRCm39) missense probably damaging 1.00
R9516:Stard9 UTSW 2 120,534,564 (GRCm39) missense probably damaging 1.00
R9570:Stard9 UTSW 2 120,534,714 (GRCm39) missense probably benign 0.02
R9649:Stard9 UTSW 2 120,526,635 (GRCm39) missense probably benign 0.20
R9789:Stard9 UTSW 2 120,510,417 (GRCm39) missense probably damaging 1.00
X0023:Stard9 UTSW 2 120,533,444 (GRCm39) missense possibly damaging 0.92
X0023:Stard9 UTSW 2 120,533,225 (GRCm39) missense probably benign 0.00
Z1176:Stard9 UTSW 2 120,528,803 (GRCm39) missense probably damaging 1.00
Z1176:Stard9 UTSW 2 120,527,093 (GRCm39) missense probably benign
Z1176:Stard9 UTSW 2 120,526,299 (GRCm39) missense probably benign 0.01
Z1177:Stard9 UTSW 2 120,504,157 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGGCTTTCACCTCTTGATGG -3'
(R):5'- AAATCTTCAGGTTCCTGGCTG -3'

Sequencing Primer
(F):5'- TCACCTCTTGATGGTTTCAGG -3'
(R):5'- TCCTGGCTGAGTAACACATG -3'
Posted On 2019-10-07