Incidental Mutation 'R7475:Ttbk2'
ID579394
Institutional Source Beutler Lab
Gene Symbol Ttbk2
Ensembl Gene ENSMUSG00000090100
Gene Nametau tubulin kinase 2
SynonymsB930008N24Rik, 2610507N02Rik, TTK
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7475 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location120732816-120850604 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120748640 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 667 (I667N)
Ref Sequence ENSEMBL: ENSMUSP00000028740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028740] [ENSMUST00000057135] [ENSMUST00000085840] [ENSMUST00000131389] [ENSMUST00000143051]
Predicted Effect probably benign
Transcript: ENSMUST00000028740
AA Change: I667N

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000028740
Gene: ENSMUSG00000090100
AA Change: I667N

DomainStartEndE-ValueType
Pfam:Pkinase 90 347 7e-31 PFAM
Pfam:Pkinase_Tyr 90 348 8.2e-19 PFAM
low complexity region 369 383 N/A INTRINSIC
low complexity region 1143 1156 N/A INTRINSIC
low complexity region 1205 1242 N/A INTRINSIC
low complexity region 1254 1271 N/A INTRINSIC
low complexity region 1285 1309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057135
AA Change: I598N

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000055032
Gene: ENSMUSG00000090100
AA Change: I598N

DomainStartEndE-ValueType
Pfam:Pkinase 21 274 1.2e-32 PFAM
Pfam:Pkinase_Tyr 21 280 3.8e-19 PFAM
low complexity region 300 314 N/A INTRINSIC
low complexity region 1074 1087 N/A INTRINSIC
low complexity region 1136 1173 N/A INTRINSIC
low complexity region 1185 1202 N/A INTRINSIC
low complexity region 1216 1240 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085840
AA Change: I598N

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000083001
Gene: ENSMUSG00000090100
AA Change: I598N

DomainStartEndE-ValueType
Pfam:Pkinase 21 274 1.2e-32 PFAM
Pfam:Pkinase_Tyr 21 280 3.8e-19 PFAM
low complexity region 300 314 N/A INTRINSIC
low complexity region 1074 1087 N/A INTRINSIC
low complexity region 1136 1173 N/A INTRINSIC
low complexity region 1185 1202 N/A INTRINSIC
low complexity region 1216 1240 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131389
SMART Domains Protein: ENSMUSP00000118905
Gene: ENSMUSG00000090100

DomainStartEndE-ValueType
Pfam:Pkinase 21 145 1.3e-18 PFAM
Pfam:Pkinase_Tyr 21 148 9.7e-12 PFAM
Pfam:Pkinase 145 239 1.2e-5 PFAM
low complexity region 265 279 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143051
AA Change: I598N

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000121996
Gene: ENSMUSG00000090100
AA Change: I598N

DomainStartEndE-ValueType
Pfam:Pkinase 21 274 2.4e-32 PFAM
Pfam:Pkinase_Tyr 21 280 7.7e-19 PFAM
low complexity region 300 314 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine-threonine kinase that putatively phosphorylates tau and tubulin proteins. Mutations in this gene cause spinocerebellar ataxia type 11 (SCA11); a neurodegenerative disease characterized by progressive ataxia and atrophy of the cerebellum and brainstem. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit complete preweaning lethality, decreased embryo size, growth retardation, and incomplete turning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G T 16: 20,399,989 N214K probably benign Het
Abcf1 A G 17: 35,963,567 probably null Het
Agxt2 A T 15: 10,409,537 M508L probably benign Het
Akr1c21 A T 13: 4,576,319 Y114F probably benign Het
Amz1 T C 5: 140,744,186 probably null Het
Ank1 G T 8: 23,132,630 A1732S probably benign Het
Atg16l1 T C 1: 87,760,083 S50P possibly damaging Het
AW551984 A G 9: 39,597,940 S302P probably damaging Het
Dedd C A 1: 171,340,313 P185Q probably benign Het
Fam186a A T 15: 99,947,514 V283E unknown Het
Fat2 C A 11: 55,303,653 V1187F probably benign Het
Fbxw11 T C 11: 32,711,999 probably null Het
Fcgbp C T 7: 28,102,976 T1443I probably damaging Het
Foxj2 A G 6: 122,837,842 D279G probably benign Het
Gbp5 A G 3: 142,501,361 D97G probably damaging Het
Gm49368 A T 7: 128,107,982 T661S possibly damaging Het
Gria4 T G 9: 4,513,330 T260P probably damaging Het
Gtf2ird2 T A 5: 134,201,426 D195E possibly damaging Het
Ikzf5 A T 7: 131,392,059 C280S probably benign Het
Ints9 G T 14: 65,026,465 E395D probably null Het
Isoc2b T C 7: 4,851,085 D96G probably benign Het
Jmjd1c T G 10: 67,225,313 S967R probably benign Het
Kcnj3 A T 2: 55,437,326 K42N probably benign Het
Kiz T C 2: 146,891,086 V394A possibly damaging Het
Knl1 A T 2: 119,087,546 H1795L probably damaging Het
Lmntd2 A G 7: 141,210,689 probably null Het
Loxhd1 C A 18: 77,412,305 D1690E possibly damaging Het
Lrp1b T C 2: 41,344,576 D1121G Het
Map3k2 T C 18: 32,199,962 V63A possibly damaging Het
Mcc G T 18: 44,476,236 A499D probably damaging Het
Mcpt9 T A 14: 56,026,943 I232F probably damaging Het
Meltf A G 16: 31,881,938 K92R probably benign Het
Mrgpra3 T A 7: 47,589,947 Y77F probably damaging Het
Ndufv2 A G 17: 66,087,537 V111A possibly damaging Het
Nkd2 T C 13: 73,825,742 E99G probably damaging Het
Nlk C A 11: 78,583,399 G358V probably damaging Het
Nnmt A T 9: 48,592,232 C165S probably damaging Het
Nxpe4 T A 9: 48,393,340 C242* probably null Het
Oas1b A T 5: 120,817,640 N162I probably damaging Het
Olfr1191-ps1 A G 2: 88,643,210 I148V probably benign Het
Otog A G 7: 46,267,276 N879S probably damaging Het
Park2 A G 17: 11,434,614 D199G probably benign Het
Pcsk7 T A 9: 45,927,625 Y612N probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pgbd5 T C 8: 124,434,011 D39G probably benign Het
Pkhd1l1 C T 15: 44,505,185 Q800* probably null Het
Pkn3 T C 2: 30,087,110 S621P probably benign Het
Polr3c T C 3: 96,715,185 I385V probably benign Het
Ppp1r21 G T 17: 88,555,603 G257W probably benign Het
Pxylp1 C T 9: 96,856,367 probably null Het
Rasgrp1 T C 2: 117,286,108 T613A probably benign Het
Robo3 C T 9: 37,425,378 V387I probably benign Het
Rxfp2 T A 5: 150,049,581 Y174N possibly damaging Het
Sec24a T C 11: 51,713,552 M746V probably damaging Het
Sema4f T A 6: 82,914,374 E571D possibly damaging Het
Sept3 T C 15: 82,286,456 V217A probably benign Het
Serpinb1b A C 13: 33,093,565 K260N probably benign Het
Sin3b A G 8: 72,749,872 T645A possibly damaging Het
Sobp C T 10: 43,021,834 R585Q probably damaging Het
Specc1l T A 10: 75,246,447 L559Q possibly damaging Het
Srxn1 C T 2: 152,105,653 probably benign Het
Sspo G A 6: 48,455,860 R890Q probably benign Het
Stard9 A G 2: 120,688,110 D505G probably damaging Het
Tjp1 A T 7: 65,322,339 I653K probably damaging Het
Tnks C T 8: 34,831,712 E1296K probably damaging Het
Usp24 T C 4: 106,342,353 S165P possibly damaging Het
Usp46 T A 5: 74,028,937 K109* probably null Het
Vmn1r191 A G 13: 22,178,772 C271R probably benign Het
Wisp3 T A 10: 39,158,300 Y102F probably damaging Het
Zfp592 T C 7: 81,023,452 S55P probably damaging Het
Zmynd15 T C 11: 70,461,041 S158P probably benign Het
Zscan22 T G 7: 12,906,737 C303G probably damaging Het
Other mutations in Ttbk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Ttbk2 APN 2 120748833 nonsense probably null
IGL00484:Ttbk2 APN 2 120773886 nonsense probably null
IGL00767:Ttbk2 APN 2 120745745 missense probably benign
IGL00809:Ttbk2 APN 2 120760269 missense probably damaging 1.00
IGL01484:Ttbk2 APN 2 120739833 missense possibly damaging 0.95
IGL01974:Ttbk2 APN 2 120786083 missense probably damaging 1.00
IGL02488:Ttbk2 APN 2 120755871 missense probably benign 0.00
IGL02874:Ttbk2 APN 2 120745712 missense probably damaging 0.99
IGL02893:Ttbk2 APN 2 120783729 missense probably damaging 1.00
IGL03210:Ttbk2 APN 2 120822492 missense probably damaging 0.99
R0279:Ttbk2 UTSW 2 120748960 missense probably benign 0.00
R0362:Ttbk2 UTSW 2 120745783 missense possibly damaging 0.90
R0376:Ttbk2 UTSW 2 120777581 missense probably damaging 1.00
R0400:Ttbk2 UTSW 2 120750242 missense probably benign 0.02
R0601:Ttbk2 UTSW 2 120825296 missense possibly damaging 0.73
R0606:Ttbk2 UTSW 2 120773872 missense probably damaging 1.00
R0664:Ttbk2 UTSW 2 120748821 missense probably damaging 0.99
R0718:Ttbk2 UTSW 2 120745160 missense probably benign 0.00
R0718:Ttbk2 UTSW 2 120748575 missense probably benign 0.01
R0783:Ttbk2 UTSW 2 120739977 missense possibly damaging 0.74
R0906:Ttbk2 UTSW 2 120783781 missense probably damaging 1.00
R1141:Ttbk2 UTSW 2 120806851 missense probably damaging 1.00
R1363:Ttbk2 UTSW 2 120806908 critical splice acceptor site probably null
R1420:Ttbk2 UTSW 2 120745912 missense probably benign 0.00
R1734:Ttbk2 UTSW 2 120755838 missense probably benign 0.01
R2033:Ttbk2 UTSW 2 120806849 missense probably damaging 0.98
R2047:Ttbk2 UTSW 2 120748916 missense probably damaging 0.99
R2893:Ttbk2 UTSW 2 120745610 unclassified probably null
R3783:Ttbk2 UTSW 2 120773815 splice site probably benign
R3785:Ttbk2 UTSW 2 120773815 splice site probably benign
R3870:Ttbk2 UTSW 2 120740019 missense probably damaging 1.00
R4024:Ttbk2 UTSW 2 120760255 missense possibly damaging 0.91
R4039:Ttbk2 UTSW 2 120745795 missense probably benign 0.01
R4060:Ttbk2 UTSW 2 120748984 missense probably benign 0.26
R4624:Ttbk2 UTSW 2 120773323 missense probably benign 0.19
R4634:Ttbk2 UTSW 2 120740192 missense probably damaging 1.00
R4708:Ttbk2 UTSW 2 120739861 missense probably damaging 1.00
R4727:Ttbk2 UTSW 2 120745370 missense probably benign 0.01
R4811:Ttbk2 UTSW 2 120740070 missense possibly damaging 0.62
R4962:Ttbk2 UTSW 2 120745150 missense probably damaging 1.00
R4964:Ttbk2 UTSW 2 120773277 missense possibly damaging 0.66
R4966:Ttbk2 UTSW 2 120773277 missense possibly damaging 0.66
R5369:Ttbk2 UTSW 2 120825262 start gained probably benign
R5430:Ttbk2 UTSW 2 120777565 missense probably damaging 1.00
R5607:Ttbk2 UTSW 2 120806824 missense possibly damaging 0.89
R5812:Ttbk2 UTSW 2 120822559 missense probably damaging 0.99
R5898:Ttbk2 UTSW 2 120745040 missense probably benign 0.08
R5951:Ttbk2 UTSW 2 120773283 missense probably benign 0.02
R6135:Ttbk2 UTSW 2 120750317 missense probably damaging 1.00
R6889:Ttbk2 UTSW 2 120773353 missense probably damaging 1.00
R6907:Ttbk2 UTSW 2 120825270 missense probably benign 0.00
R7013:Ttbk2 UTSW 2 120745784 missense possibly damaging 0.89
R7128:Ttbk2 UTSW 2 120746088 missense probably benign 0.00
R7173:Ttbk2 UTSW 2 120740111 missense probably damaging 1.00
R7358:Ttbk2 UTSW 2 120790310 missense probably damaging 1.00
RF010:Ttbk2 UTSW 2 120790339 nonsense probably null
RF021:Ttbk2 UTSW 2 120748634 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCATTTCTTACCGCAGTCAGG -3'
(R):5'- GCTGTTAACTTAAGCTCTTGCAAAC -3'

Sequencing Primer
(F):5'- AGTCAGGGGTCCTTCTGC -3'
(R):5'- CTCTTGCAAACAGGAGGTTGATTCC -3'
Posted On2019-10-07