Incidental Mutation 'R7475:Usp46'
ID579400
Institutional Source Beutler Lab
Gene Symbol Usp46
Ensembl Gene ENSMUSG00000054814
Gene Nameubiquitin specific peptidase 46
Synonyms1190009E20Rik, 2410018I08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock #R7475 (G1)
Quality Score131.008
Status Not validated
Chromosome5
Chromosomal Location73998453-74068431 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 74028937 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 109 (K109*)
Ref Sequence ENSEMBL: ENSMUSP00000144284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068058] [ENSMUST00000119154] [ENSMUST00000145016] [ENSMUST00000152408]
Predicted Effect probably benign
Transcript: ENSMUST00000068058
SMART Domains Protein: ENSMUSP00000070554
Gene: ENSMUSG00000054814

DomainStartEndE-ValueType
Pfam:UCH 34 362 6.8e-67 PFAM
Pfam:UCH_1 35 335 1.5e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119154
SMART Domains Protein: ENSMUSP00000114060
Gene: ENSMUSG00000054814

DomainStartEndE-ValueType
Pfam:UCH 9 335 4.1e-67 PFAM
Pfam:UCH_1 11 308 2.9e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145016
SMART Domains Protein: ENSMUSP00000114395
Gene: ENSMUSG00000054814

DomainStartEndE-ValueType
Pfam:UCH 27 122 4.4e-30 PFAM
Pfam:UCH_1 28 122 3.6e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000152408
AA Change: K109*
SMART Domains Protein: ENSMUSP00000144284
Gene: ENSMUSG00000054814
AA Change: K109*

DomainStartEndE-ValueType
Pfam:UCH 1 132 1e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP46 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit reduced depression-related behaviors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G T 16: 20,399,989 N214K probably benign Het
Abcf1 A G 17: 35,963,567 probably null Het
Agxt2 A T 15: 10,409,537 M508L probably benign Het
Akr1c21 A T 13: 4,576,319 Y114F probably benign Het
Amz1 T C 5: 140,744,186 probably null Het
Ank1 G T 8: 23,132,630 A1732S probably benign Het
Atg16l1 T C 1: 87,760,083 S50P possibly damaging Het
AW551984 A G 9: 39,597,940 S302P probably damaging Het
Dedd C A 1: 171,340,313 P185Q probably benign Het
Fam186a A T 15: 99,947,514 V283E unknown Het
Fat2 C A 11: 55,303,653 V1187F probably benign Het
Fbxw11 T C 11: 32,711,999 probably null Het
Fcgbp C T 7: 28,102,976 T1443I probably damaging Het
Foxj2 A G 6: 122,837,842 D279G probably benign Het
Gbp5 A G 3: 142,501,361 D97G probably damaging Het
Gm49368 A T 7: 128,107,982 T661S possibly damaging Het
Gria4 T G 9: 4,513,330 T260P probably damaging Het
Gtf2ird2 T A 5: 134,201,426 D195E possibly damaging Het
Ikzf5 A T 7: 131,392,059 C280S probably benign Het
Ints9 G T 14: 65,026,465 E395D probably null Het
Isoc2b T C 7: 4,851,085 D96G probably benign Het
Jmjd1c T G 10: 67,225,313 S967R probably benign Het
Kcnj3 A T 2: 55,437,326 K42N probably benign Het
Kiz T C 2: 146,891,086 V394A possibly damaging Het
Knl1 A T 2: 119,087,546 H1795L probably damaging Het
Lmntd2 A G 7: 141,210,689 probably null Het
Loxhd1 C A 18: 77,412,305 D1690E possibly damaging Het
Lrp1b T C 2: 41,344,576 D1121G Het
Map3k2 T C 18: 32,199,962 V63A possibly damaging Het
Mcc G T 18: 44,476,236 A499D probably damaging Het
Mcpt9 T A 14: 56,026,943 I232F probably damaging Het
Meltf A G 16: 31,881,938 K92R probably benign Het
Mrgpra3 T A 7: 47,589,947 Y77F probably damaging Het
Ndufv2 A G 17: 66,087,537 V111A possibly damaging Het
Nkd2 T C 13: 73,825,742 E99G probably damaging Het
Nlk C A 11: 78,583,399 G358V probably damaging Het
Nnmt A T 9: 48,592,232 C165S probably damaging Het
Nxpe4 T A 9: 48,393,340 C242* probably null Het
Oas1b A T 5: 120,817,640 N162I probably damaging Het
Olfr1191-ps1 A G 2: 88,643,210 I148V probably benign Het
Otog A G 7: 46,267,276 N879S probably damaging Het
Park2 A G 17: 11,434,614 D199G probably benign Het
Pcsk7 T A 9: 45,927,625 Y612N probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pgbd5 T C 8: 124,434,011 D39G probably benign Het
Pkhd1l1 C T 15: 44,505,185 Q800* probably null Het
Pkn3 T C 2: 30,087,110 S621P probably benign Het
Polr3c T C 3: 96,715,185 I385V probably benign Het
Ppp1r21 G T 17: 88,555,603 G257W probably benign Het
Pxylp1 C T 9: 96,856,367 probably null Het
Rasgrp1 T C 2: 117,286,108 T613A probably benign Het
Robo3 C T 9: 37,425,378 V387I probably benign Het
Rxfp2 T A 5: 150,049,581 Y174N possibly damaging Het
Sec24a T C 11: 51,713,552 M746V probably damaging Het
Sema4f T A 6: 82,914,374 E571D possibly damaging Het
Sept3 T C 15: 82,286,456 V217A probably benign Het
Serpinb1b A C 13: 33,093,565 K260N probably benign Het
Sin3b A G 8: 72,749,872 T645A possibly damaging Het
Sobp C T 10: 43,021,834 R585Q probably damaging Het
Specc1l T A 10: 75,246,447 L559Q possibly damaging Het
Srxn1 C T 2: 152,105,653 probably benign Het
Sspo G A 6: 48,455,860 R890Q probably benign Het
Stard9 A G 2: 120,688,110 D505G probably damaging Het
Tjp1 A T 7: 65,322,339 I653K probably damaging Het
Tnks C T 8: 34,831,712 E1296K probably damaging Het
Ttbk2 A T 2: 120,748,640 I667N probably benign Het
Usp24 T C 4: 106,342,353 S165P possibly damaging Het
Vmn1r191 A G 13: 22,178,772 C271R probably benign Het
Wisp3 T A 10: 39,158,300 Y102F probably damaging Het
Zfp592 T C 7: 81,023,452 S55P probably damaging Het
Zmynd15 T C 11: 70,461,041 S158P probably benign Het
Zscan22 T G 7: 12,906,737 C303G probably damaging Het
Other mutations in Usp46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Usp46 APN 5 74002686 missense probably null 0.03
IGL00401:Usp46 APN 5 74003171 missense probably damaging 1.00
IGL00949:Usp46 APN 5 74003242 missense possibly damaging 0.67
IGL02108:Usp46 APN 5 74029206 missense probably damaging 1.00
IGL02325:Usp46 APN 5 74037028 splice site probably null
IGL02383:Usp46 APN 5 74029353 missense probably benign 0.22
IGL02400:Usp46 APN 5 74037052 missense probably benign 0.00
IGL02833:Usp46 APN 5 74016682 missense probably benign 0.01
R0091:Usp46 UTSW 5 74003257 missense probably benign 0.25
R1186:Usp46 UTSW 5 74002122 missense probably benign 0.01
R1714:Usp46 UTSW 5 74003167 missense probably benign 0.35
R4023:Usp46 UTSW 5 74032475 missense probably damaging 1.00
R4051:Usp46 UTSW 5 74002755 missense probably benign 0.01
R4239:Usp46 UTSW 5 74032267 unclassified probably benign
R4240:Usp46 UTSW 5 74032267 unclassified probably benign
R5542:Usp46 UTSW 5 74029241 missense probably benign 0.03
R5907:Usp46 UTSW 5 74037085 missense probably benign 0.05
R6442:Usp46 UTSW 5 74016716 missense probably benign 0.01
R6770:Usp46 UTSW 5 74032354 missense probably benign 0.00
R6856:Usp46 UTSW 5 74028934 unclassified probably benign
R7080:Usp46 UTSW 5 74016683 missense probably benign 0.31
R7430:Usp46 UTSW 5 74003188 missense probably damaging 1.00
R7782:Usp46 UTSW 5 74002111 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTGAGCTCTTCATGGTGAG -3'
(R):5'- GCTTGAACTGTGAAACTGTGAG -3'

Sequencing Primer
(F):5'- AGAACCTTATTAAGTGGGTCACGGTC -3'
(R):5'- ACTGTGAAACTGTGAGTACTGGC -3'
Posted On2019-10-07