Incidental Mutation 'R7475:Gtf2ird2'
ID579402
Institutional Source Beutler Lab
Gene Symbol Gtf2ird2
Ensembl Gene ENSMUSG00000015942
Gene NameGTF2I repeat domain containing 2
Synonyms1700012P16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R7475 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location134184019-134224355 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 134201426 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 195 (D195E)
Ref Sequence ENSEMBL: ENSMUSP00000016086 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016086] [ENSMUST00000123941]
Predicted Effect possibly damaging
Transcript: ENSMUST00000016086
AA Change: D195E

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000016086
Gene: ENSMUSG00000015942
AA Change: D195E

DomainStartEndE-ValueType
Pfam:GTF2I 104 178 6.1e-31 PFAM
Pfam:GTF2I 328 402 1.6e-25 PFAM
Blast:Tryp_SPc 436 491 4e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123941
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G T 16: 20,399,989 N214K probably benign Het
Abcf1 A G 17: 35,963,567 probably null Het
Agxt2 A T 15: 10,409,537 M508L probably benign Het
Akr1c21 A T 13: 4,576,319 Y114F probably benign Het
Amz1 T C 5: 140,744,186 probably null Het
Ank1 G T 8: 23,132,630 A1732S probably benign Het
Atg16l1 T C 1: 87,760,083 S50P possibly damaging Het
AW551984 A G 9: 39,597,940 S302P probably damaging Het
Ces3a T A 8: 105,053,690 probably null Het
Dedd C A 1: 171,340,313 P185Q probably benign Het
Fam186a A T 15: 99,947,514 V283E unknown Het
Fat2 C A 11: 55,303,653 V1187F probably benign Het
Fbxw11 T C 11: 32,711,999 probably null Het
Fcgbp C T 7: 28,102,976 T1443I probably damaging Het
Foxj2 A G 6: 122,837,842 D279G probably benign Het
Gbp5 A G 3: 142,501,361 D97G probably damaging Het
Gm49368 A T 7: 128,107,982 T661S possibly damaging Het
Gria4 T G 9: 4,513,330 T260P probably damaging Het
Hectd4 T A 5: 121,358,133 probably null Het
Ifngr2 G A 16: 91,557,909 C32Y unknown Het
Ikzf5 A T 7: 131,392,059 C280S probably benign Het
Ints9 G T 14: 65,026,465 E395D probably null Het
Isoc2b T C 7: 4,851,085 D96G probably benign Het
Jmjd1c T G 10: 67,225,313 S967R probably benign Het
Kcnj3 A T 2: 55,437,326 K42N probably benign Het
Kiz T C 2: 146,891,086 V394A possibly damaging Het
Knl1 A T 2: 119,087,546 H1795L probably damaging Het
Lmntd2 A G 7: 141,210,689 probably null Het
Loxhd1 C A 18: 77,412,305 D1690E possibly damaging Het
Lrp1b T C 2: 41,344,576 D1121G Het
Map3k2 T C 18: 32,199,962 V63A possibly damaging Het
Mcc G T 18: 44,476,236 A499D probably damaging Het
Mcpt9 T A 14: 56,026,943 I232F probably damaging Het
Meltf A G 16: 31,881,938 K92R probably benign Het
Mff T A 1: 82,745,438 probably null Het
Mrgpra3 T A 7: 47,589,947 Y77F probably damaging Het
Mylk G A 16: 34,914,076 probably null Het
Ndufv2 A G 17: 66,087,537 V111A possibly damaging Het
Nkd2 T C 13: 73,825,742 E99G probably damaging Het
Nlk C A 11: 78,583,399 G358V probably damaging Het
Nnmt A T 9: 48,592,232 C165S probably damaging Het
Nxpe4 T A 9: 48,393,340 C242* probably null Het
Oas1b A T 5: 120,817,640 N162I probably damaging Het
Olfr1191-ps1 A G 2: 88,643,210 I148V probably benign Het
Otog A G 7: 46,267,276 N879S probably damaging Het
Park2 A G 17: 11,434,614 D199G probably benign Het
Pcsk7 T A 9: 45,927,625 Y612N probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pgbd5 T C 8: 124,434,011 D39G probably benign Het
Pkhd1l1 C T 15: 44,505,185 Q800* probably null Het
Pkn3 T C 2: 30,087,110 S621P probably benign Het
Polr3c T C 3: 96,715,185 I385V probably benign Het
Ppp1r21 G T 17: 88,555,603 G257W probably benign Het
Pxylp1 C T 9: 96,856,367 probably null Het
Rasgrp1 T C 2: 117,286,108 T613A probably benign Het
Robo3 C T 9: 37,425,378 V387I probably benign Het
Rxfp2 T A 5: 150,049,581 Y174N possibly damaging Het
Sec24a T C 11: 51,713,552 M746V probably damaging Het
Sema4f T A 6: 82,914,374 E571D possibly damaging Het
Sept3 T C 15: 82,286,456 V217A probably benign Het
Serpinb1b A C 13: 33,093,565 K260N probably benign Het
Sin3b A G 8: 72,749,872 T645A possibly damaging Het
Sobp C T 10: 43,021,834 R585Q probably damaging Het
Specc1l T A 10: 75,246,447 L559Q possibly damaging Het
Srxn1 C T 2: 152,105,653 probably benign Het
Sspo G A 6: 48,455,860 R890Q probably benign Het
Stard9 A G 2: 120,688,110 D505G probably damaging Het
Tjp1 A T 7: 65,322,339 I653K probably damaging Het
Tnks C T 8: 34,831,712 E1296K probably damaging Het
Ttbk2 A T 2: 120,748,640 I667N probably benign Het
Usp24 T C 4: 106,342,353 S165P possibly damaging Het
Usp46 T A 5: 74,028,937 K109* probably null Het
Vmn1r191 A G 13: 22,178,772 C271R probably benign Het
Wisp3 T A 10: 39,158,300 Y102F probably damaging Het
Zfp592 T C 7: 81,023,452 S55P probably damaging Het
Zmynd15 T C 11: 70,461,041 S158P probably benign Het
Zscan22 T G 7: 12,906,737 C303G probably damaging Het
Other mutations in Gtf2ird2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Gtf2ird2 APN 5 134196553 missense possibly damaging 0.93
IGL01295:Gtf2ird2 APN 5 134192764 missense probably damaging 1.00
IGL01603:Gtf2ird2 APN 5 134202288 splice site probably benign
IGL01824:Gtf2ird2 APN 5 134197282 splice site probably benign
IGL02469:Gtf2ird2 APN 5 134191249 missense probably damaging 1.00
IGL02525:Gtf2ird2 APN 5 134216477 missense probably benign 0.03
IGL02567:Gtf2ird2 APN 5 134213048 unclassified probably benign
IGL02750:Gtf2ird2 APN 5 134216889 missense probably damaging 0.99
IGL02992:Gtf2ird2 APN 5 134217614 missense possibly damaging 0.79
IGL03000:Gtf2ird2 APN 5 134194906 missense probably benign 0.45
IGL03114:Gtf2ird2 APN 5 134216910 splice site probably null
IGL03180:Gtf2ird2 APN 5 134191248 missense probably damaging 1.00
R0077:Gtf2ird2 UTSW 5 134214083 missense probably damaging 1.00
R0100:Gtf2ird2 UTSW 5 134217015 missense probably damaging 0.97
R0100:Gtf2ird2 UTSW 5 134217015 missense probably damaging 0.97
R0344:Gtf2ird2 UTSW 5 134191249 missense probably damaging 1.00
R0568:Gtf2ird2 UTSW 5 134211242 nonsense probably null
R0570:Gtf2ird2 UTSW 5 134208944 critical splice donor site probably null
R0730:Gtf2ird2 UTSW 5 134192758 nonsense probably null
R0826:Gtf2ird2 UTSW 5 134216955 missense probably damaging 1.00
R1707:Gtf2ird2 UTSW 5 134216987 missense probably damaging 1.00
R1710:Gtf2ird2 UTSW 5 134211240 missense probably benign 0.26
R2064:Gtf2ird2 UTSW 5 134216498 nonsense probably null
R2284:Gtf2ird2 UTSW 5 134217183 missense probably benign 0.05
R2375:Gtf2ird2 UTSW 5 134217135 missense probably benign 0.20
R3104:Gtf2ird2 UTSW 5 134208915 missense probably benign 0.42
R4436:Gtf2ird2 UTSW 5 134194969 missense possibly damaging 0.95
R4647:Gtf2ird2 UTSW 5 134216192 missense probably damaging 1.00
R4708:Gtf2ird2 UTSW 5 134216298 missense probably damaging 0.99
R4775:Gtf2ird2 UTSW 5 134214128 missense probably benign 0.01
R4999:Gtf2ird2 UTSW 5 134217464 missense probably damaging 0.97
R5011:Gtf2ird2 UTSW 5 134216982 missense possibly damaging 0.90
R5036:Gtf2ird2 UTSW 5 134217507 missense probably damaging 1.00
R5261:Gtf2ird2 UTSW 5 134216219 missense probably benign 0.00
R5379:Gtf2ird2 UTSW 5 134217468 missense probably benign
R5921:Gtf2ird2 UTSW 5 134217584 missense probably damaging 1.00
R6180:Gtf2ird2 UTSW 5 134216547 missense probably damaging 1.00
R6483:Gtf2ird2 UTSW 5 134211225 missense probably benign 0.00
R7355:Gtf2ird2 UTSW 5 134216649 missense probably benign 0.24
R7566:Gtf2ird2 UTSW 5 134214006 missense probably damaging 1.00
R8021:Gtf2ird2 UTSW 5 134203334 missense probably benign
R8701:Gtf2ird2 UTSW 5 134216235 missense probably damaging 1.00
R8756:Gtf2ird2 UTSW 5 134197249 missense possibly damaging 0.80
R8898:Gtf2ird2 UTSW 5 134197265 missense probably benign
R8946:Gtf2ird2 UTSW 5 134216319 missense probably damaging 1.00
R8955:Gtf2ird2 UTSW 5 134216754 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GACTGGCCTCGTTCCCTG -3'
(R):5'- ATCCAGGTCAAGGATTAGGATG -3'

Sequencing Primer
(F):5'- GCTAGCACTTCTGCCATGG -3'
(R):5'- GTGCTGAGAACCATACTGGAATCTC -3'
Posted On2019-10-07