Incidental Mutation 'R7475:Tnks'
ID579420
Institutional Source Beutler Lab
Gene Symbol Tnks
Ensembl Gene ENSMUSG00000031529
Gene Nametankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase
SynonymsmTNKS1, 4930554K12Rik, D130072O21Rik, TANK1, tankyrase 1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7475 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location34826460-34965690 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 34831712 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1296 (E1296K)
Ref Sequence ENSEMBL: ENSMUSP00000033929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033929]
PDB Structure
Crystal structure of a mouse Tankyrase-Axin complex [X-RAY DIFFRACTION]
Co-crystal structure of tankyrase 1 with compound 3 [(4S)-3-{4-[6-amino-5-(pyrimidin-2-yl)pyridin-3-yl]phenyl}-5,5-dimethyl-4-phenyl-1,3-oxazolidin-2-one] [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000033929
AA Change: E1296K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033929
Gene: ENSMUSG00000031529
AA Change: E1296K

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
low complexity region 20 55 N/A INTRINSIC
low complexity region 68 86 N/A INTRINSIC
low complexity region 91 175 N/A INTRINSIC
ANK 208 237 4.26e-4 SMART
ANK 241 270 3.23e-4 SMART
ANK 274 303 3.28e-5 SMART
ANK 327 355 2.66e3 SMART
ANK 361 390 7.64e-6 SMART
ANK 394 423 2.62e-4 SMART
ANK 427 456 1.99e-4 SMART
ANK 514 546 3.18e-3 SMART
ANK 550 579 1.51e-4 SMART
ANK 583 612 4.26e-4 SMART
ANK 642 670 2.21e3 SMART
ANK 676 705 4.03e-5 SMART
ANK 709 738 2.48e-5 SMART
ANK 742 771 1.64e-5 SMART
low complexity region 792 810 N/A INTRINSIC
ANK 829 858 1.47e-7 SMART
ANK 862 891 2.21e-2 SMART
ANK 895 924 3.13e-2 SMART
low complexity region 996 1010 N/A INTRINSIC
SAM 1017 1082 1.14e-12 SMART
Pfam:PARP 1098 1303 1.5e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209632
Predicted Effect probably benign
Transcript: ENSMUST00000210014
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele fail to exhibit any abonormalities. Male mice homozygous for a gene trapped allele exhibit decreased fat pad weight, increased metabolism, hyperinsulinemia, and hypoglycemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G T 16: 20,399,989 N214K probably benign Het
Abcf1 A G 17: 35,963,567 probably null Het
Agxt2 A T 15: 10,409,537 M508L probably benign Het
Akr1c21 A T 13: 4,576,319 Y114F probably benign Het
Amz1 T C 5: 140,744,186 probably null Het
Ank1 G T 8: 23,132,630 A1732S probably benign Het
Atg16l1 T C 1: 87,760,083 S50P possibly damaging Het
AW551984 A G 9: 39,597,940 S302P probably damaging Het
Dedd C A 1: 171,340,313 P185Q probably benign Het
Fam186a A T 15: 99,947,514 V283E unknown Het
Fat2 C A 11: 55,303,653 V1187F probably benign Het
Fbxw11 T C 11: 32,711,999 probably null Het
Fcgbp C T 7: 28,102,976 T1443I probably damaging Het
Foxj2 A G 6: 122,837,842 D279G probably benign Het
Gbp5 A G 3: 142,501,361 D97G probably damaging Het
Gm49368 A T 7: 128,107,982 T661S possibly damaging Het
Gria4 T G 9: 4,513,330 T260P probably damaging Het
Gtf2ird2 T A 5: 134,201,426 D195E possibly damaging Het
Ikzf5 A T 7: 131,392,059 C280S probably benign Het
Ints9 G T 14: 65,026,465 E395D probably null Het
Isoc2b T C 7: 4,851,085 D96G probably benign Het
Jmjd1c T G 10: 67,225,313 S967R probably benign Het
Kcnj3 A T 2: 55,437,326 K42N probably benign Het
Kiz T C 2: 146,891,086 V394A possibly damaging Het
Knl1 A T 2: 119,087,546 H1795L probably damaging Het
Lmntd2 A G 7: 141,210,689 probably null Het
Loxhd1 C A 18: 77,412,305 D1690E possibly damaging Het
Lrp1b T C 2: 41,344,576 D1121G Het
Map3k2 T C 18: 32,199,962 V63A possibly damaging Het
Mcc G T 18: 44,476,236 A499D probably damaging Het
Mcpt9 T A 14: 56,026,943 I232F probably damaging Het
Meltf A G 16: 31,881,938 K92R probably benign Het
Mrgpra3 T A 7: 47,589,947 Y77F probably damaging Het
Ndufv2 A G 17: 66,087,537 V111A possibly damaging Het
Nkd2 T C 13: 73,825,742 E99G probably damaging Het
Nlk C A 11: 78,583,399 G358V probably damaging Het
Nnmt A T 9: 48,592,232 C165S probably damaging Het
Nxpe4 T A 9: 48,393,340 C242* probably null Het
Oas1b A T 5: 120,817,640 N162I probably damaging Het
Olfr1191-ps1 A G 2: 88,643,210 I148V probably benign Het
Otog A G 7: 46,267,276 N879S probably damaging Het
Park2 A G 17: 11,434,614 D199G probably benign Het
Pcsk7 T A 9: 45,927,625 Y612N probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pgbd5 T C 8: 124,434,011 D39G probably benign Het
Pkhd1l1 C T 15: 44,505,185 Q800* probably null Het
Pkn3 T C 2: 30,087,110 S621P probably benign Het
Polr3c T C 3: 96,715,185 I385V probably benign Het
Ppp1r21 G T 17: 88,555,603 G257W probably benign Het
Pxylp1 C T 9: 96,856,367 probably null Het
Rasgrp1 T C 2: 117,286,108 T613A probably benign Het
Robo3 C T 9: 37,425,378 V387I probably benign Het
Rxfp2 T A 5: 150,049,581 Y174N possibly damaging Het
Sec24a T C 11: 51,713,552 M746V probably damaging Het
Sema4f T A 6: 82,914,374 E571D possibly damaging Het
Sept3 T C 15: 82,286,456 V217A probably benign Het
Serpinb1b A C 13: 33,093,565 K260N probably benign Het
Sin3b A G 8: 72,749,872 T645A possibly damaging Het
Sobp C T 10: 43,021,834 R585Q probably damaging Het
Specc1l T A 10: 75,246,447 L559Q possibly damaging Het
Srxn1 C T 2: 152,105,653 probably benign Het
Sspo G A 6: 48,455,860 R890Q probably benign Het
Stard9 A G 2: 120,688,110 D505G probably damaging Het
Tjp1 A T 7: 65,322,339 I653K probably damaging Het
Ttbk2 A T 2: 120,748,640 I667N probably benign Het
Usp24 T C 4: 106,342,353 S165P possibly damaging Het
Usp46 T A 5: 74,028,937 K109* probably null Het
Vmn1r191 A G 13: 22,178,772 C271R probably benign Het
Wisp3 T A 10: 39,158,300 Y102F probably damaging Het
Zfp592 T C 7: 81,023,452 S55P probably damaging Het
Zmynd15 T C 11: 70,461,041 S158P probably benign Het
Zscan22 T G 7: 12,906,737 C303G probably damaging Het
Other mutations in Tnks
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Tnks APN 8 34861689 splice site probably benign
IGL00901:Tnks APN 8 34838395 nonsense probably null
IGL01448:Tnks APN 8 34839982 missense probably damaging 1.00
IGL01455:Tnks APN 8 34940900 missense probably damaging 0.99
IGL01962:Tnks APN 8 34869524 missense probably damaging 1.00
IGL02088:Tnks APN 8 34839994 missense possibly damaging 0.50
IGL02260:Tnks APN 8 34842983 missense probably damaging 0.99
IGL02454:Tnks APN 8 34831728 unclassified probably benign
IGL02486:Tnks APN 8 34851198 missense probably damaging 1.00
IGL02612:Tnks APN 8 34849299 missense possibly damaging 0.48
IGL03179:Tnks APN 8 34848670 missense probably benign 0.38
IGL03404:Tnks APN 8 34940704 missense probably damaging 1.00
R0256:Tnks UTSW 8 34861547 missense probably benign 0.07
R0265:Tnks UTSW 8 34839970 nonsense probably null
R0334:Tnks UTSW 8 34853259 nonsense probably null
R0414:Tnks UTSW 8 34853309 missense probably damaging 1.00
R0526:Tnks UTSW 8 34853303 missense probably benign 0.23
R0622:Tnks UTSW 8 34940822 missense probably damaging 1.00
R1445:Tnks UTSW 8 34834603 splice site probably benign
R1618:Tnks UTSW 8 34875276 missense probably damaging 1.00
R1779:Tnks UTSW 8 34857518 missense probably benign 0.18
R1919:Tnks UTSW 8 34875232 missense probably damaging 1.00
R1938:Tnks UTSW 8 34838530 missense probably damaging 1.00
R2018:Tnks UTSW 8 34851106 missense probably damaging 1.00
R2198:Tnks UTSW 8 34848649 missense probably benign
R2198:Tnks UTSW 8 34873067 missense probably benign 0.29
R2925:Tnks UTSW 8 34965661 missense unknown
R3828:Tnks UTSW 8 34873178 missense probably damaging 1.00
R3913:Tnks UTSW 8 34873074 missense probably damaging 0.99
R3916:Tnks UTSW 8 34853361 missense probably damaging 1.00
R3917:Tnks UTSW 8 34853361 missense probably damaging 1.00
R3930:Tnks UTSW 8 34940812 missense probably damaging 1.00
R4659:Tnks UTSW 8 34849311 missense possibly damaging 0.53
R4760:Tnks UTSW 8 34851783 missense probably benign 0.38
R5091:Tnks UTSW 8 34841809 missense probably benign 0.40
R5419:Tnks UTSW 8 34965566 missense unknown
R5558:Tnks UTSW 8 34965665 start codon destroyed probably null
R5582:Tnks UTSW 8 34940861 missense probably benign 0.14
R6035:Tnks UTSW 8 34918461 missense possibly damaging 0.93
R6035:Tnks UTSW 8 34918461 missense possibly damaging 0.93
R6495:Tnks UTSW 8 34839966 critical splice donor site probably null
R6527:Tnks UTSW 8 34873093 missense probably benign 0.36
R6991:Tnks UTSW 8 34834493 missense probably damaging 1.00
R7015:Tnks UTSW 8 34838547 missense probably benign 0.04
R7038:Tnks UTSW 8 34851636 missense probably damaging 0.99
R7057:Tnks UTSW 8 34840014 missense probably damaging 1.00
R7167:Tnks UTSW 8 34849304 missense probably damaging 0.98
R7250:Tnks UTSW 8 34851758 missense probably damaging 0.98
R7790:Tnks UTSW 8 34861540 missense probably benign 0.01
R7818:Tnks UTSW 8 34873028 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AAGACAGCTTATTTCTTGGCTGTTG -3'
(R):5'- GCTGCTGCTAGATAGAGTGC -3'

Sequencing Primer
(F):5'- GGCTGTTGGGATTTAGAGAATATTG -3'
(R):5'- AGTTCATGTGAGCAAGGTGC -3'
Posted On2019-10-07