Mutagenetix > Incidental Mutation

Incidental Mutation 'R7475:Gria4'

579423

Institutional Source

Beutler Lab

Gene Symbol

Gria4

Ensembl Gene

ENSMUSG00000025892

Gene Name

glutamate receptor, ionotropic, AMPA4 (alpha 4)

Synonyms

Gluralpha4, spkw1, Glur4, Glur-4

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.682) question?

Stock #

R7475 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

4417896-4796234 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 4513330 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Proline at position 260 (T260P)

Ref Sequence

ENSEMBL: ENSMUSP00000066980 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027020] [ENSMUST00000063508] [ENSMUST00000163309] [ENSMUST00000212533]

AlphaFold

Q9Z2W8

Predicted Effect

probably damaging
Transcript: ENSMUST00000027020
AA Change: T260P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000027020
Gene: ENSMUSG00000025892
AA Change: T260P

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	39	380	3e-61	PFAM
PBPe	416	791	8.23e-129	SMART
Lig_chan-Glu_bd	426	491	3.4e-31	SMART
low complexity region	821	833	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000063508
AA Change: T260P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000066980
Gene: ENSMUSG00000025892
AA Change: T260P

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	39	380	2.5e-71	PFAM
PBPe	416	791	2.06e-129	SMART
Lig_chan-Glu_bd	426	491	3.4e-31	SMART
low complexity region	821	833	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000163309
AA Change: T260P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000129316
Gene: ENSMUSG00000025892
AA Change: T260P

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	39	380	3.2e-62	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000212533
AA Change: T260P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes composed of multiple subunits, arranged to form ligand-gated ion channels. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. The subunit encoded by this gene belongs to a family of AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate)-sensitive glutamate receptors, and is subject to RNA editing (AGA->GGA; R->G). Alternative splicing of this gene results in transcript variants encoding different isoforms, which may vary in their signal transduction properties. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display hyperactivity, decreased thermal nociception, and abnormal sensitivity to pharmacologically induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc5	G	T	16: 20,399,989	N214K	probably benign	Het
Abcf1	A	G	17: 35,963,567		probably null	Het
Agxt2	A	T	15: 10,409,537	M508L	probably benign	Het
Akr1c21	A	T	13: 4,576,319	Y114F	probably benign	Het
Amz1	T	C	5: 140,744,186		probably null	Het
Ank1	G	T	8: 23,132,630	A1732S	probably benign	Het
Atg16l1	T	C	1: 87,760,083	S50P	possibly damaging	Het
AW551984	A	G	9: 39,597,940	S302P	probably damaging	Het
Ces3a	T	A	8: 105,053,690		probably null	Het
Dedd	C	A	1: 171,340,313	P185Q	probably benign	Het
Fam186a	A	T	15: 99,947,514	V283E	unknown	Het
Fat2	C	A	11: 55,303,653	V1187F	probably benign	Het
Fbxw11	T	C	11: 32,711,999		probably null	Het
Fcgbp	C	T	7: 28,102,976	T1443I	probably damaging	Het
Foxj2	A	G	6: 122,837,842	D279G	probably benign	Het
Gbp5	A	G	3: 142,501,361	D97G	probably damaging	Het
Gm49368	A	T	7: 128,107,982	T661S	possibly damaging	Het
Gtf2ird2	T	A	5: 134,201,426	D195E	possibly damaging	Het
Hectd4	T	A	5: 121,358,133		probably null	Het
Ifngr2	G	A	16: 91,557,909	C32Y	unknown	Het
Ikzf5	A	T	7: 131,392,059	C280S	probably benign	Het
Ints9	G	T	14: 65,026,465	E395D	probably null	Het
Isoc2b	T	C	7: 4,851,085	D96G	probably benign	Het
Jmjd1c	T	G	10: 67,225,313	S967R	probably benign	Het
Kcnj3	A	T	2: 55,437,326	K42N	probably benign	Het
Kiz	T	C	2: 146,891,086	V394A	possibly damaging	Het
Knl1	A	T	2: 119,087,546	H1795L	probably damaging	Het
Lmntd2	A	G	7: 141,210,689		probably null	Het
Loxhd1	C	A	18: 77,412,305	D1690E	possibly damaging	Het
Lrp1b	T	C	2: 41,344,576	D1121G		Het
Map3k2	T	C	18: 32,199,962	V63A	possibly damaging	Het
Mcc	G	T	18: 44,476,236	A499D	probably damaging	Het
Mcpt9	T	A	14: 56,026,943	I232F	probably damaging	Het
Meltf	A	G	16: 31,881,938	K92R	probably benign	Het
Mff	T	A	1: 82,745,438		probably null	Het
Mrgpra3	T	A	7: 47,589,947	Y77F	probably damaging	Het
Mylk	G	A	16: 34,914,076		probably null	Het
Ndufv2	A	G	17: 66,087,537	V111A	possibly damaging	Het
Nkd2	T	C	13: 73,825,742	E99G	probably damaging	Het
Nlk	C	A	11: 78,583,399	G358V	probably damaging	Het
Nnmt	A	T	9: 48,592,232	C165S	probably damaging	Het
Nxpe4	T	A	9: 48,393,340	C242*	probably null	Het
Oas1b	A	T	5: 120,817,640	N162I	probably damaging	Het
Olfr1191-ps1	A	G	2: 88,643,210	I148V	probably benign	Het
Otog	A	G	7: 46,267,276	N879S	probably damaging	Het
Park2	A	G	17: 11,434,614	D199G	probably benign	Het
Pcsk7	T	A	9: 45,927,625	Y612N	probably damaging	Het
Peg10	CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG	CCACATCAGGATCCACATCAGGATGCACATCAG	6: 4,756,398		probably benign	Het
Pgbd5	T	C	8: 124,434,011	D39G	probably benign	Het
Pkhd1l1	C	T	15: 44,505,185	Q800*	probably null	Het
Pkn3	T	C	2: 30,087,110	S621P	probably benign	Het
Polr3c	T	C	3: 96,715,185	I385V	probably benign	Het
Ppp1r21	G	T	17: 88,555,603	G257W	probably benign	Het
Pxylp1	C	T	9: 96,856,367		probably null	Het
Rasgrp1	T	C	2: 117,286,108	T613A	probably benign	Het
Robo3	C	T	9: 37,425,378	V387I	probably benign	Het
Rxfp2	T	A	5: 150,049,581	Y174N	possibly damaging	Het
Sec24a	T	C	11: 51,713,552	M746V	probably damaging	Het
Sema4f	T	A	6: 82,914,374	E571D	possibly damaging	Het
Sept3	T	C	15: 82,286,456	V217A	probably benign	Het
Serpinb1b	A	C	13: 33,093,565	K260N	probably benign	Het
Sin3b	A	G	8: 72,749,872	T645A	possibly damaging	Het
Sobp	C	T	10: 43,021,834	R585Q	probably damaging	Het
Specc1l	T	A	10: 75,246,447	L559Q	possibly damaging	Het
Srxn1	C	T	2: 152,105,653		probably benign	Het
Sspo	G	A	6: 48,455,860	R890Q	probably benign	Het
Stard9	A	G	2: 120,688,110	D505G	probably damaging	Het
Tjp1	A	T	7: 65,322,339	I653K	probably damaging	Het
Tnks	C	T	8: 34,831,712	E1296K	probably damaging	Het
Ttbk2	A	T	2: 120,748,640	I667N	probably benign	Het
Usp24	T	C	4: 106,342,353	S165P	possibly damaging	Het
Usp46	T	A	5: 74,028,937	K109*	probably null	Het
Vmn1r191	A	G	13: 22,178,772	C271R	probably benign	Het
Wisp3	T	A	10: 39,158,300	Y102F	probably damaging	Het
Zfp592	T	C	7: 81,023,452	S55P	probably damaging	Het
Zmynd15	T	C	11: 70,461,041	S158P	probably benign	Het
Zscan22	T	G	7: 12,906,737	C303G	probably damaging	Het

Other mutations in Gria4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00814:Gria4	APN	9	4472202	missense	probably damaging	0.98
IGL01451:Gria4	APN	9	4503652	missense	probably benign	0.04
IGL01533:Gria4	APN	9	4502395	missense	probably damaging	1.00
IGL01994:Gria4	APN	9	4537726	missense	probably damaging	1.00
IGL02078:Gria4	APN	9	4793878	missense	probably damaging	0.98
IGL02183:Gria4	APN	9	4502460	missense	probably damaging	1.00
IGL02351:Gria4	APN	9	4456206	missense	possibly damaging	0.84
IGL02358:Gria4	APN	9	4456206	missense	possibly damaging	0.84
IGL03118:Gria4	APN	9	4793804	splice site	probably benign
IGL03131:Gria4	APN	9	4432876	missense	probably damaging	0.96
IGL03148:Gria4	APN	9	4464295	missense	possibly damaging	0.91
IGL03264:Gria4	APN	9	4513288	missense	probably benign
PIT4812001:Gria4	UTSW	9	4427128	missense	probably damaging	1.00
R0018:Gria4	UTSW	9	4432843	missense	possibly damaging	0.71
R0295:Gria4	UTSW	9	4793840	missense	possibly damaging	0.69
R0654:Gria4	UTSW	9	4464372	missense	probably benign	0.32
R0690:Gria4	UTSW	9	4427071	missense	probably damaging	1.00
R0992:Gria4	UTSW	9	4795238	missense	probably benign
R1517:Gria4	UTSW	9	4793865	missense	probably damaging	1.00
R1673:Gria4	UTSW	9	4537637	nonsense	probably null
R1713:Gria4	UTSW	9	4424448	missense	probably benign	0.20
R1961:Gria4	UTSW	9	4519546	splice site	probably benign
R2137:Gria4	UTSW	9	4427026	intron	probably benign
R2397:Gria4	UTSW	9	4537717	missense	probably damaging	1.00
R2870:Gria4	UTSW	9	4503614	missense	probably damaging	0.96
R2870:Gria4	UTSW	9	4503614	missense	probably damaging	0.96
R3014:Gria4	UTSW	9	4464294	missense	probably damaging	0.97
R3412:Gria4	UTSW	9	4513278	missense	probably benign	0.00
R3732:Gria4	UTSW	9	4513295	missense	probably benign
R3732:Gria4	UTSW	9	4513295	missense	probably benign
R3733:Gria4	UTSW	9	4513295	missense	probably benign
R3897:Gria4	UTSW	9	4513260	missense	probably damaging	1.00
R4404:Gria4	UTSW	9	4464489	splice site	probably null
R4457:Gria4	UTSW	9	4427074	missense	probably damaging	1.00
R4672:Gria4	UTSW	9	4664981	missense	possibly damaging	0.96
R4865:Gria4	UTSW	9	4464295	missense	possibly damaging	0.91
R5092:Gria4	UTSW	9	4472176	missense	probably benign	0.01
R5109:Gria4	UTSW	9	4472168	missense	probably damaging	1.00
R5202:Gria4	UTSW	9	4424330	missense	probably benign	0.10
R5828:Gria4	UTSW	9	4432832	missense	probably damaging	1.00
R5945:Gria4	UTSW	9	4456122	missense	probably damaging	1.00
R5985:Gria4	UTSW	9	4503593	missense	probably damaging	0.99
R6036:Gria4	UTSW	9	4537646	missense	probably benign	0.00
R6036:Gria4	UTSW	9	4537646	missense	probably benign	0.00
R6111:Gria4	UTSW	9	4502430	missense	probably damaging	1.00
R6190:Gria4	UTSW	9	4420199	missense	probably benign
R6280:Gria4	UTSW	9	4456072	missense	probably damaging	1.00
R6406:Gria4	UTSW	9	4427077	missense	probably damaging	1.00
R6470:Gria4	UTSW	9	4503680	missense	probably damaging	1.00
R6485:Gria4	UTSW	9	4464249	missense	probably damaging	1.00
R6612:Gria4	UTSW	9	4472206	missense	possibly damaging	0.93
R6848:Gria4	UTSW	9	4793822	missense	probably damaging	1.00
R7046:Gria4	UTSW	9	4420278	missense	probably damaging	0.97
R7210:Gria4	UTSW	9	4464135	missense	probably damaging	1.00
R7284:Gria4	UTSW	9	4472017	missense	probably damaging	1.00
R7501:Gria4	UTSW	9	4502436	missense	probably benign	0.01
R7536:Gria4	UTSW	9	4464298	missense	probably damaging	1.00
R7604:Gria4	UTSW	9	4464315	missense	probably damaging	1.00
R7643:Gria4	UTSW	9	4793950	missense	probably benign	0.00
R7669:Gria4	UTSW	9	4462029	missense	probably damaging	1.00
R7703:Gria4	UTSW	9	4503588	missense	probably benign
R7720:Gria4	UTSW	9	4464288	missense	probably damaging	1.00
R7724:Gria4	UTSW	9	4472074	missense	probably damaging	1.00
R7909:Gria4	UTSW	9	4464450	missense	probably damaging	1.00
R8007:Gria4	UTSW	9	4503740	splice site	probably benign
R8044:Gria4	UTSW	9	4456216	missense	probably damaging	1.00
R8062:Gria4	UTSW	9	4480273	missense	possibly damaging	0.54
R8131:Gria4	UTSW	9	4502429	missense	probably benign	0.16
R8212:Gria4	UTSW	9	4480242	missense	probably benign
R8478:Gria4	UTSW	9	4793882	missense	probably damaging	1.00
R8699:Gria4	UTSW	9	4424347	missense	probably damaging	1.00
R8699:Gria4	UTSW	9	4424351	missense	probably damaging	1.00
R8785:Gria4	UTSW	9	4456106	missense	probably damaging	1.00
R8785:Gria4	UTSW	9	4795189	missense	possibly damaging	0.92
R8888:Gria4	UTSW	9	4664951	missense	probably damaging	1.00
R8895:Gria4	UTSW	9	4664951	missense	probably damaging	1.00
R9160:Gria4	UTSW	9	4424412	missense	probably damaging	1.00
R9498:Gria4	UTSW	9	4503560	critical splice donor site	probably null
R9743:Gria4	UTSW	9	4464457	missense	probably damaging	1.00
X0023:Gria4	UTSW	9	4427067	missense	probably damaging	1.00
X0065:Gria4	UTSW	9	4464340	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- TGGCTTGGCAGTTAAGAAAAC -3'
(R):5'- TCTTCTTAGATCAACAGGCATGG -3'

Sequencing Primer
(F):5'- GCCATGCGGTAGCTTATAAGC -3'
(R):5'- ACAGGCATGGAATTATACAAACTC -3'

Posted On

2019-10-07