Incidental Mutation 'R7475:Akr1c21'
ID 579439
Institutional Source Beutler Lab
Gene Symbol Akr1c21
Ensembl Gene ENSMUSG00000021207
Gene Name aldo-keto reductase family 1, member C21
Synonyms 9430025F20Rik
MMRRC Submission 045549-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.056) question?
Stock # R7475 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 4624074-4636540 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 4626318 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 114 (Y114F)
Ref Sequence ENSEMBL: ENSMUSP00000021628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021628] [ENSMUST00000223285]
AlphaFold Q91WR5
PDB Structure Crystal structure of 17alpha-hydroxysteroid dehydrogenase in binary complex with NADP(H) in an open conformation [X-RAY DIFFRACTION]
Crystal structure of 17alpha-hydroxysteroid dehydrogenase in its apo-form [X-RAY DIFFRACTION]
Crystal structure of 17alpha-hydroxysteroid dehydrogenase in complex with NADP(H) in a closed conformation [X-RAY DIFFRACTION]
Crystal structure of 17alpha-hydroxysteroid dehydrogenase in complex with NADP+ and epi-testosterone [X-RAY DIFFRACTION]
Crystal structure of 17alpha-hydroxysteroid dehydrogenase mutant K31A in complex with NADP+ and epi-testosterone [X-RAY DIFFRACTION]
Crystal structure of mouse 17-alpha hydroxysteroid dehydrogenase in complex with coenzyme NADPH [X-RAY DIFFRACTION]
The crystal structure of mouse 17-alpha hydroxysteroid dehydrogenase GG225.226PP mutant in complex with inhibitor and cofactor NADP+. [X-RAY DIFFRACTION]
The crystal structure of 17-alpha hydroxysteroid dehydrogenase Y224D mutant. [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000021628
AA Change: Y114F

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000021628
Gene: ENSMUSG00000021207
AA Change: Y114F

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 18 301 2.2e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223285
AA Change: Y114F

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G T 16: 20,218,739 (GRCm39) N214K probably benign Het
Abcf1 A G 17: 36,274,459 (GRCm39) probably null Het
Agxt2 A T 15: 10,409,623 (GRCm39) M508L probably benign Het
Amz1 T C 5: 140,729,941 (GRCm39) probably null Het
Ank1 G T 8: 23,622,646 (GRCm39) A1732S probably benign Het
Atg16l1 T C 1: 87,687,805 (GRCm39) S50P possibly damaging Het
AW551984 A G 9: 39,509,236 (GRCm39) S302P probably damaging Het
Ccn6 T A 10: 39,034,296 (GRCm39) Y102F probably damaging Het
Ces3a T A 8: 105,780,322 (GRCm39) probably null Het
Dedd C A 1: 171,167,881 (GRCm39) P185Q probably benign Het
Fam186a A T 15: 99,845,395 (GRCm39) V283E unknown Het
Fat2 C A 11: 55,194,479 (GRCm39) V1187F probably benign Het
Fbxw11 T C 11: 32,661,999 (GRCm39) probably null Het
Fcgbp C T 7: 27,802,401 (GRCm39) T1443I probably damaging Het
Foxj2 A G 6: 122,814,801 (GRCm39) D279G probably benign Het
Gbp5 A G 3: 142,207,122 (GRCm39) D97G probably damaging Het
Gm49368 A T 7: 127,707,154 (GRCm39) T661S possibly damaging Het
Gria4 T G 9: 4,513,330 (GRCm39) T260P probably damaging Het
Gtf2ird2 T A 5: 134,230,267 (GRCm39) D195E possibly damaging Het
Hectd4 T A 5: 121,496,196 (GRCm39) probably null Het
Ifngr2 G A 16: 91,354,797 (GRCm39) C32Y unknown Het
Ikzf5 A T 7: 130,993,788 (GRCm39) C280S probably benign Het
Ints9 G T 14: 65,263,914 (GRCm39) E395D probably null Het
Isoc2b T C 7: 4,854,084 (GRCm39) D96G probably benign Het
Jmjd1c T G 10: 67,061,092 (GRCm39) S967R probably benign Het
Kcnj3 A T 2: 55,327,338 (GRCm39) K42N probably benign Het
Kiz T C 2: 146,733,006 (GRCm39) V394A possibly damaging Het
Knl1 A T 2: 118,918,027 (GRCm39) H1795L probably damaging Het
Lmntd2 A G 7: 140,790,602 (GRCm39) probably null Het
Loxhd1 C A 18: 77,500,001 (GRCm39) D1690E possibly damaging Het
Lrp1b T C 2: 41,234,588 (GRCm39) D1121G Het
Map3k2 T C 18: 32,333,015 (GRCm39) V63A possibly damaging Het
Mcc G T 18: 44,609,303 (GRCm39) A499D probably damaging Het
Mcpt9 T A 14: 56,264,400 (GRCm39) I232F probably damaging Het
Meltf A G 16: 31,700,756 (GRCm39) K92R probably benign Het
Mff T A 1: 82,723,159 (GRCm39) probably null Het
Mrgpra3 T A 7: 47,239,695 (GRCm39) Y77F probably damaging Het
Mylk G A 16: 34,734,446 (GRCm39) probably null Het
Ndufv2 A G 17: 66,394,532 (GRCm39) V111A possibly damaging Het
Nkd2 T C 13: 73,973,861 (GRCm39) E99G probably damaging Het
Nlk C A 11: 78,474,225 (GRCm39) G358V probably damaging Het
Nnmt A T 9: 48,503,532 (GRCm39) C165S probably damaging Het
Nxpe4 T A 9: 48,304,640 (GRCm39) C242* probably null Het
Oas1b A T 5: 120,955,705 (GRCm39) N162I probably damaging Het
Or4s2 A G 2: 88,473,554 (GRCm39) I148V probably benign Het
Otog A G 7: 45,916,700 (GRCm39) N879S probably damaging Het
Pcsk7 T A 9: 45,838,923 (GRCm39) Y612N probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Pgbd5 T C 8: 125,160,750 (GRCm39) D39G probably benign Het
Pkhd1l1 C T 15: 44,368,581 (GRCm39) Q800* probably null Het
Pkn3 T C 2: 29,977,122 (GRCm39) S621P probably benign Het
Polr3c T C 3: 96,622,501 (GRCm39) I385V probably benign Het
Ppp1r21 G T 17: 88,863,031 (GRCm39) G257W probably benign Het
Prkn A G 17: 11,653,501 (GRCm39) D199G probably benign Het
Pxylp1 C T 9: 96,738,420 (GRCm39) probably null Het
Rasgrp1 T C 2: 117,116,589 (GRCm39) T613A probably benign Het
Robo3 C T 9: 37,336,674 (GRCm39) V387I probably benign Het
Rxfp2 T A 5: 149,973,046 (GRCm39) Y174N possibly damaging Het
Sec24a T C 11: 51,604,379 (GRCm39) M746V probably damaging Het
Sema4f T A 6: 82,891,355 (GRCm39) E571D possibly damaging Het
Septin3 T C 15: 82,170,657 (GRCm39) V217A probably benign Het
Serpinb1b A C 13: 33,277,548 (GRCm39) K260N probably benign Het
Sin3b A G 8: 73,476,500 (GRCm39) T645A possibly damaging Het
Sobp C T 10: 42,897,830 (GRCm39) R585Q probably damaging Het
Specc1l T A 10: 75,082,281 (GRCm39) L559Q possibly damaging Het
Srxn1 C T 2: 151,947,573 (GRCm39) probably benign Het
Sspo G A 6: 48,432,794 (GRCm39) R890Q probably benign Het
Stard9 A G 2: 120,518,591 (GRCm39) D505G probably damaging Het
Tjp1 A T 7: 64,972,087 (GRCm39) I653K probably damaging Het
Tnks C T 8: 35,298,866 (GRCm39) E1296K probably damaging Het
Ttbk2 A T 2: 120,579,121 (GRCm39) I667N probably benign Het
Usp24 T C 4: 106,199,550 (GRCm39) S165P possibly damaging Het
Usp46 T A 5: 74,189,598 (GRCm39) K109* probably null Het
Vmn1r191 A G 13: 22,362,942 (GRCm39) C271R probably benign Het
Zfp592 T C 7: 80,673,200 (GRCm39) S55P probably damaging Het
Zmynd15 T C 11: 70,351,867 (GRCm39) S158P probably benign Het
Zscan22 T G 7: 12,640,664 (GRCm39) C303G probably damaging Het
Other mutations in Akr1c21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00645:Akr1c21 APN 13 4,626,312 (GRCm39) missense probably damaging 1.00
IGL01093:Akr1c21 APN 13 4,631,139 (GRCm39) splice site probably benign
IGL01408:Akr1c21 APN 13 4,627,431 (GRCm39) missense probably benign
IGL02470:Akr1c21 APN 13 4,627,406 (GRCm39) missense probably damaging 1.00
IGL02683:Akr1c21 APN 13 4,626,312 (GRCm39) missense probably damaging 1.00
IGL02738:Akr1c21 APN 13 4,630,300 (GRCm39) missense probably damaging 1.00
IGL03126:Akr1c21 APN 13 4,627,457 (GRCm39) missense possibly damaging 0.76
IGL03365:Akr1c21 APN 13 4,633,851 (GRCm39) missense probably benign 0.00
R0166:Akr1c21 UTSW 13 4,631,263 (GRCm39) missense probably damaging 1.00
R0391:Akr1c21 UTSW 13 4,631,199 (GRCm39) missense probably damaging 1.00
R0505:Akr1c21 UTSW 13 4,626,306 (GRCm39) missense probably damaging 1.00
R1069:Akr1c21 UTSW 13 4,625,333 (GRCm39) splice site probably benign
R1168:Akr1c21 UTSW 13 4,633,836 (GRCm39) missense probably benign 0.04
R1617:Akr1c21 UTSW 13 4,626,351 (GRCm39) splice site probably null
R1686:Akr1c21 UTSW 13 4,627,452 (GRCm39) missense probably damaging 1.00
R1694:Akr1c21 UTSW 13 4,625,177 (GRCm39) missense probably damaging 0.98
R1753:Akr1c21 UTSW 13 4,627,134 (GRCm39) nonsense probably null
R1977:Akr1c21 UTSW 13 4,624,211 (GRCm39) missense probably damaging 1.00
R2005:Akr1c21 UTSW 13 4,624,214 (GRCm39) missense probably damaging 1.00
R2036:Akr1c21 UTSW 13 4,626,305 (GRCm39) missense probably damaging 0.98
R2198:Akr1c21 UTSW 13 4,627,464 (GRCm39) missense probably damaging 1.00
R2925:Akr1c21 UTSW 13 4,626,349 (GRCm39) splice site probably null
R4965:Akr1c21 UTSW 13 4,630,304 (GRCm39) missense probably damaging 1.00
R6245:Akr1c21 UTSW 13 4,625,231 (GRCm39) missense possibly damaging 0.93
R6381:Akr1c21 UTSW 13 4,624,183 (GRCm39) missense probably damaging 1.00
R6711:Akr1c21 UTSW 13 4,627,374 (GRCm39) missense probably damaging 1.00
R6843:Akr1c21 UTSW 13 4,625,213 (GRCm39) missense probably damaging 1.00
R6998:Akr1c21 UTSW 13 4,633,850 (GRCm39) missense probably benign 0.05
R7253:Akr1c21 UTSW 13 4,627,139 (GRCm39) missense probably damaging 1.00
R8389:Akr1c21 UTSW 13 4,626,278 (GRCm39) missense probably damaging 0.96
R8391:Akr1c21 UTSW 13 4,626,278 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCCTGTGCACATCAATTTCAAATCAG -3'
(R):5'- CACCCTTCAGTGGTAGGATTC -3'

Sequencing Primer
(F):5'- CTTCAATTGCAGGTTTGGTG -3'
(R):5'- CCGCTTGGTTGATAAACAGTC -3'
Posted On 2019-10-07