Incidental Mutation 'R7475:Serpinb1b'
ID579441
Institutional Source Beutler Lab
Gene Symbol Serpinb1b
Ensembl Gene ENSMUSG00000051029
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 1b
Synonymsovalbumin, EIB, 6330533H24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R7475 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location33078575-33094380 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 33093565 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 260 (K260N)
Ref Sequence ENSEMBL: ENSMUSP00000016951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016951]
Predicted Effect probably benign
Transcript: ENSMUST00000016951
AA Change: K260N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000016951
Gene: ENSMUSG00000051029
AA Change: K260N

DomainStartEndE-ValueType
SERPIN 13 382 9e-182 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G T 16: 20,399,989 N214K probably benign Het
Abcf1 A G 17: 35,963,567 probably null Het
Agxt2 A T 15: 10,409,537 M508L probably benign Het
Akr1c21 A T 13: 4,576,319 Y114F probably benign Het
Amz1 T C 5: 140,744,186 probably null Het
Ank1 G T 8: 23,132,630 A1732S probably benign Het
Atg16l1 T C 1: 87,760,083 S50P possibly damaging Het
AW551984 A G 9: 39,597,940 S302P probably damaging Het
Dedd C A 1: 171,340,313 P185Q probably benign Het
Fam186a A T 15: 99,947,514 V283E unknown Het
Fat2 C A 11: 55,303,653 V1187F probably benign Het
Fbxw11 T C 11: 32,711,999 probably null Het
Fcgbp C T 7: 28,102,976 T1443I probably damaging Het
Foxj2 A G 6: 122,837,842 D279G probably benign Het
Gbp5 A G 3: 142,501,361 D97G probably damaging Het
Gm49368 A T 7: 128,107,982 T661S possibly damaging Het
Gria4 T G 9: 4,513,330 T260P probably damaging Het
Gtf2ird2 T A 5: 134,201,426 D195E possibly damaging Het
Ikzf5 A T 7: 131,392,059 C280S probably benign Het
Ints9 G T 14: 65,026,465 E395D probably null Het
Isoc2b T C 7: 4,851,085 D96G probably benign Het
Jmjd1c T G 10: 67,225,313 S967R probably benign Het
Kcnj3 A T 2: 55,437,326 K42N probably benign Het
Kiz T C 2: 146,891,086 V394A possibly damaging Het
Knl1 A T 2: 119,087,546 H1795L probably damaging Het
Lmntd2 A G 7: 141,210,689 probably null Het
Loxhd1 C A 18: 77,412,305 D1690E possibly damaging Het
Lrp1b T C 2: 41,344,576 D1121G Het
Map3k2 T C 18: 32,199,962 V63A possibly damaging Het
Mcc G T 18: 44,476,236 A499D probably damaging Het
Mcpt9 T A 14: 56,026,943 I232F probably damaging Het
Meltf A G 16: 31,881,938 K92R probably benign Het
Mrgpra3 T A 7: 47,589,947 Y77F probably damaging Het
Ndufv2 A G 17: 66,087,537 V111A possibly damaging Het
Nkd2 T C 13: 73,825,742 E99G probably damaging Het
Nlk C A 11: 78,583,399 G358V probably damaging Het
Nnmt A T 9: 48,592,232 C165S probably damaging Het
Nxpe4 T A 9: 48,393,340 C242* probably null Het
Oas1b A T 5: 120,817,640 N162I probably damaging Het
Olfr1191-ps1 A G 2: 88,643,210 I148V probably benign Het
Otog A G 7: 46,267,276 N879S probably damaging Het
Park2 A G 17: 11,434,614 D199G probably benign Het
Pcsk7 T A 9: 45,927,625 Y612N probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pgbd5 T C 8: 124,434,011 D39G probably benign Het
Pkhd1l1 C T 15: 44,505,185 Q800* probably null Het
Pkn3 T C 2: 30,087,110 S621P probably benign Het
Polr3c T C 3: 96,715,185 I385V probably benign Het
Ppp1r21 G T 17: 88,555,603 G257W probably benign Het
Pxylp1 C T 9: 96,856,367 probably null Het
Rasgrp1 T C 2: 117,286,108 T613A probably benign Het
Robo3 C T 9: 37,425,378 V387I probably benign Het
Rxfp2 T A 5: 150,049,581 Y174N possibly damaging Het
Sec24a T C 11: 51,713,552 M746V probably damaging Het
Sema4f T A 6: 82,914,374 E571D possibly damaging Het
Sept3 T C 15: 82,286,456 V217A probably benign Het
Sin3b A G 8: 72,749,872 T645A possibly damaging Het
Sobp C T 10: 43,021,834 R585Q probably damaging Het
Specc1l T A 10: 75,246,447 L559Q possibly damaging Het
Srxn1 C T 2: 152,105,653 probably benign Het
Sspo G A 6: 48,455,860 R890Q probably benign Het
Stard9 A G 2: 120,688,110 D505G probably damaging Het
Tjp1 A T 7: 65,322,339 I653K probably damaging Het
Tnks C T 8: 34,831,712 E1296K probably damaging Het
Ttbk2 A T 2: 120,748,640 I667N probably benign Het
Usp24 T C 4: 106,342,353 S165P possibly damaging Het
Usp46 T A 5: 74,028,937 K109* probably null Het
Vmn1r191 A G 13: 22,178,772 C271R probably benign Het
Wisp3 T A 10: 39,158,300 Y102F probably damaging Het
Zfp592 T C 7: 81,023,452 S55P probably damaging Het
Zmynd15 T C 11: 70,461,041 S158P probably benign Het
Zscan22 T G 7: 12,906,737 C303G probably damaging Het
Other mutations in Serpinb1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Serpinb1b APN 13 33093867 missense probably damaging 1.00
IGL01348:Serpinb1b APN 13 33091415 missense probably benign 0.25
IGL01413:Serpinb1b APN 13 33093859 missense probably damaging 0.98
IGL01942:Serpinb1b APN 13 33085311 missense possibly damaging 0.69
IGL02065:Serpinb1b APN 13 33091318 missense possibly damaging 0.66
IGL02707:Serpinb1b APN 13 33091665 missense probably benign 0.41
IGL03149:Serpinb1b APN 13 33085292 missense possibly damaging 0.90
R0087:Serpinb1b UTSW 13 33085319 missense probably benign 0.02
R0279:Serpinb1b UTSW 13 33093713 missense possibly damaging 0.81
R0448:Serpinb1b UTSW 13 33089692 missense probably benign 0.01
R1605:Serpinb1b UTSW 13 33093663 missense possibly damaging 0.82
R1628:Serpinb1b UTSW 13 33093654 missense probably benign 0.00
R1955:Serpinb1b UTSW 13 33085439 missense probably benign 0.08
R6124:Serpinb1b UTSW 13 33093813 missense probably benign 0.01
R6632:Serpinb1b UTSW 13 33087455 missense probably damaging 0.97
R7205:Serpinb1b UTSW 13 33087423 missense probably benign 0.07
R7296:Serpinb1b UTSW 13 33093827 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- CTTGGACCCTCAAAGACCTG -3'
(R):5'- ACCTGAATAATGCCTCCTGTGG -3'

Sequencing Primer
(F):5'- CCTCAAAGACCTGAAATAGTTCTG -3'
(R):5'- GCTCATTAACATCCACAAATGACTTG -3'
Posted On2019-10-07