Incidental Mutation 'R7475:Ints9'
ID579444
Institutional Source Beutler Lab
Gene Symbol Ints9
Ensembl Gene ENSMUSG00000021975
Gene Nameintegrator complex subunit 9
SynonymsD14Ertd231e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7475 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location64950045-65039832 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 65026465 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 395 (E395D)
Ref Sequence ENSEMBL: ENSMUSP00000045552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043914]
Predicted Effect probably null
Transcript: ENSMUST00000043914
AA Change: E395D

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000045552
Gene: ENSMUSG00000021975
AA Change: E395D

DomainStartEndE-ValueType
Pfam:Lactamase_B_6 91 289 1.2e-17 PFAM
Beta-Casp 334 462 7.65e-16 SMART
low complexity region 583 596 N/A INTRINSIC
low complexity region 672 682 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the Integrator complex. This protein complex binds the C-terminal domain of RNA polymerase II and likely plays a role in small nuclear RNA processing. The encoded protein has similarities to the subunits of the cleavage and polyadenylation specificity factor complex. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G T 16: 20,399,989 N214K probably benign Het
Abcf1 A G 17: 35,963,567 probably null Het
Agxt2 A T 15: 10,409,537 M508L probably benign Het
Akr1c21 A T 13: 4,576,319 Y114F probably benign Het
Amz1 T C 5: 140,744,186 probably null Het
Ank1 G T 8: 23,132,630 A1732S probably benign Het
Atg16l1 T C 1: 87,760,083 S50P possibly damaging Het
AW551984 A G 9: 39,597,940 S302P probably damaging Het
Dedd C A 1: 171,340,313 P185Q probably benign Het
Fam186a A T 15: 99,947,514 V283E unknown Het
Fat2 C A 11: 55,303,653 V1187F probably benign Het
Fbxw11 T C 11: 32,711,999 probably null Het
Fcgbp C T 7: 28,102,976 T1443I probably damaging Het
Foxj2 A G 6: 122,837,842 D279G probably benign Het
Gbp5 A G 3: 142,501,361 D97G probably damaging Het
Gm49368 A T 7: 128,107,982 T661S possibly damaging Het
Gria4 T G 9: 4,513,330 T260P probably damaging Het
Gtf2ird2 T A 5: 134,201,426 D195E possibly damaging Het
Ikzf5 A T 7: 131,392,059 C280S probably benign Het
Isoc2b T C 7: 4,851,085 D96G probably benign Het
Jmjd1c T G 10: 67,225,313 S967R probably benign Het
Kcnj3 A T 2: 55,437,326 K42N probably benign Het
Kiz T C 2: 146,891,086 V394A possibly damaging Het
Knl1 A T 2: 119,087,546 H1795L probably damaging Het
Lmntd2 A G 7: 141,210,689 probably null Het
Loxhd1 C A 18: 77,412,305 D1690E possibly damaging Het
Lrp1b T C 2: 41,344,576 D1121G Het
Map3k2 T C 18: 32,199,962 V63A possibly damaging Het
Mcc G T 18: 44,476,236 A499D probably damaging Het
Mcpt9 T A 14: 56,026,943 I232F probably damaging Het
Meltf A G 16: 31,881,938 K92R probably benign Het
Mrgpra3 T A 7: 47,589,947 Y77F probably damaging Het
Ndufv2 A G 17: 66,087,537 V111A possibly damaging Het
Nkd2 T C 13: 73,825,742 E99G probably damaging Het
Nlk C A 11: 78,583,399 G358V probably damaging Het
Nnmt A T 9: 48,592,232 C165S probably damaging Het
Nxpe4 T A 9: 48,393,340 C242* probably null Het
Oas1b A T 5: 120,817,640 N162I probably damaging Het
Olfr1191-ps1 A G 2: 88,643,210 I148V probably benign Het
Otog A G 7: 46,267,276 N879S probably damaging Het
Park2 A G 17: 11,434,614 D199G probably benign Het
Pcsk7 T A 9: 45,927,625 Y612N probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pgbd5 T C 8: 124,434,011 D39G probably benign Het
Pkhd1l1 C T 15: 44,505,185 Q800* probably null Het
Pkn3 T C 2: 30,087,110 S621P probably benign Het
Polr3c T C 3: 96,715,185 I385V probably benign Het
Ppp1r21 G T 17: 88,555,603 G257W probably benign Het
Pxylp1 C T 9: 96,856,367 probably null Het
Rasgrp1 T C 2: 117,286,108 T613A probably benign Het
Robo3 C T 9: 37,425,378 V387I probably benign Het
Rxfp2 T A 5: 150,049,581 Y174N possibly damaging Het
Sec24a T C 11: 51,713,552 M746V probably damaging Het
Sema4f T A 6: 82,914,374 E571D possibly damaging Het
Sept3 T C 15: 82,286,456 V217A probably benign Het
Serpinb1b A C 13: 33,093,565 K260N probably benign Het
Sin3b A G 8: 72,749,872 T645A possibly damaging Het
Sobp C T 10: 43,021,834 R585Q probably damaging Het
Specc1l T A 10: 75,246,447 L559Q possibly damaging Het
Srxn1 C T 2: 152,105,653 probably benign Het
Sspo G A 6: 48,455,860 R890Q probably benign Het
Stard9 A G 2: 120,688,110 D505G probably damaging Het
Tjp1 A T 7: 65,322,339 I653K probably damaging Het
Tnks C T 8: 34,831,712 E1296K probably damaging Het
Ttbk2 A T 2: 120,748,640 I667N probably benign Het
Usp24 T C 4: 106,342,353 S165P possibly damaging Het
Usp46 T A 5: 74,028,937 K109* probably null Het
Vmn1r191 A G 13: 22,178,772 C271R probably benign Het
Wisp3 T A 10: 39,158,300 Y102F probably damaging Het
Zfp592 T C 7: 81,023,452 S55P probably damaging Het
Zmynd15 T C 11: 70,461,041 S158P probably benign Het
Zscan22 T G 7: 12,906,737 C303G probably damaging Het
Other mutations in Ints9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Ints9 APN 14 65037421 missense probably benign 0.00
IGL02374:Ints9 APN 14 65039333 missense probably benign 0.00
IGL02728:Ints9 APN 14 64993008 missense probably damaging 1.00
IGL02992:Ints9 APN 14 64980164 missense probably benign 0.08
IGL03151:Ints9 APN 14 65032340 missense possibly damaging 0.86
R0437:Ints9 UTSW 14 64986369 splice site probably benign
R0582:Ints9 UTSW 14 64980149 missense probably damaging 1.00
R1525:Ints9 UTSW 14 64995011 missense probably benign 0.05
R1569:Ints9 UTSW 14 64980122 missense possibly damaging 0.91
R1835:Ints9 UTSW 14 65032256 missense probably damaging 1.00
R1839:Ints9 UTSW 14 65016530 missense probably damaging 1.00
R1862:Ints9 UTSW 14 65026413 missense probably benign
R1892:Ints9 UTSW 14 65020423 missense probably benign 0.08
R2146:Ints9 UTSW 14 64986343 missense possibly damaging 0.71
R2285:Ints9 UTSW 14 65007997 missense possibly damaging 0.61
R3015:Ints9 UTSW 14 64950278 missense probably benign 0.00
R4133:Ints9 UTSW 14 64990554 missense probably benign
R4180:Ints9 UTSW 14 64992981 missense probably damaging 1.00
R4509:Ints9 UTSW 14 65028932 missense possibly damaging 0.96
R4510:Ints9 UTSW 14 65028932 missense possibly damaging 0.96
R4511:Ints9 UTSW 14 65028932 missense possibly damaging 0.96
R4608:Ints9 UTSW 14 65032280 missense possibly damaging 0.82
R5023:Ints9 UTSW 14 64980228 missense probably damaging 1.00
R5117:Ints9 UTSW 14 64993091 nonsense probably null
R5261:Ints9 UTSW 14 65008072 missense probably benign 0.25
R5582:Ints9 UTSW 14 65028896 missense possibly damaging 0.83
R5990:Ints9 UTSW 14 65039328 missense probably damaging 1.00
R6009:Ints9 UTSW 14 65008082 missense probably benign 0.43
R6241:Ints9 UTSW 14 64980210 missense possibly damaging 0.90
R6351:Ints9 UTSW 14 64993007 missense probably damaging 0.98
R6821:Ints9 UTSW 14 65037458 missense probably benign 0.20
R7422:Ints9 UTSW 14 65032298 missense possibly damaging 0.93
R7442:Ints9 UTSW 14 64995064 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATTCAGAGTCAATGCCAGAGTG -3'
(R):5'- GTGCTGGAGTACTTTTCAACC -3'

Sequencing Primer
(F):5'- GTCAATGCCAGAGTGAAAGC -3'
(R):5'- ACTTTGTAAACCAGGCTGGC -3'
Posted On2019-10-07