Incidental Mutation 'R7475:Ppp1r21'
ID579454
Institutional Source Beutler Lab
Gene Symbol Ppp1r21
Ensembl Gene ENSMUSG00000034709
Gene Nameprotein phosphatase 1, regulatory subunit 21
SynonymsKlraq1, 1110018J12Rik, Ccdc128
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.308) question?
Stock #R7475 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location88530118-88588367 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 88555603 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 257 (G257W)
Ref Sequence ENSEMBL: ENSMUSP00000048443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038551]
Predicted Effect probably benign
Transcript: ENSMUST00000038551
AA Change: G257W

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000048443
Gene: ENSMUSG00000034709
AA Change: G257W

DomainStartEndE-ValueType
KLRAQ 11 112 8.01e-51 SMART
coiled coil region 136 211 N/A INTRINSIC
Pfam:TTKRSYEDQ 255 771 1.8e-273 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G T 16: 20,399,989 N214K probably benign Het
Abcf1 A G 17: 35,963,567 probably null Het
Agxt2 A T 15: 10,409,537 M508L probably benign Het
Akr1c21 A T 13: 4,576,319 Y114F probably benign Het
Amz1 T C 5: 140,744,186 probably null Het
Ank1 G T 8: 23,132,630 A1732S probably benign Het
Atg16l1 T C 1: 87,760,083 S50P possibly damaging Het
AW551984 A G 9: 39,597,940 S302P probably damaging Het
Dedd C A 1: 171,340,313 P185Q probably benign Het
Fam186a A T 15: 99,947,514 V283E unknown Het
Fat2 C A 11: 55,303,653 V1187F probably benign Het
Fbxw11 T C 11: 32,711,999 probably null Het
Fcgbp C T 7: 28,102,976 T1443I probably damaging Het
Foxj2 A G 6: 122,837,842 D279G probably benign Het
Gbp5 A G 3: 142,501,361 D97G probably damaging Het
Gm49368 A T 7: 128,107,982 T661S possibly damaging Het
Gria4 T G 9: 4,513,330 T260P probably damaging Het
Gtf2ird2 T A 5: 134,201,426 D195E possibly damaging Het
Ikzf5 A T 7: 131,392,059 C280S probably benign Het
Ints9 G T 14: 65,026,465 E395D probably null Het
Isoc2b T C 7: 4,851,085 D96G probably benign Het
Jmjd1c T G 10: 67,225,313 S967R probably benign Het
Kcnj3 A T 2: 55,437,326 K42N probably benign Het
Kiz T C 2: 146,891,086 V394A possibly damaging Het
Knl1 A T 2: 119,087,546 H1795L probably damaging Het
Lmntd2 A G 7: 141,210,689 probably null Het
Loxhd1 C A 18: 77,412,305 D1690E possibly damaging Het
Lrp1b T C 2: 41,344,576 D1121G Het
Map3k2 T C 18: 32,199,962 V63A possibly damaging Het
Mcc G T 18: 44,476,236 A499D probably damaging Het
Mcpt9 T A 14: 56,026,943 I232F probably damaging Het
Meltf A G 16: 31,881,938 K92R probably benign Het
Mrgpra3 T A 7: 47,589,947 Y77F probably damaging Het
Ndufv2 A G 17: 66,087,537 V111A possibly damaging Het
Nkd2 T C 13: 73,825,742 E99G probably damaging Het
Nlk C A 11: 78,583,399 G358V probably damaging Het
Nnmt A T 9: 48,592,232 C165S probably damaging Het
Nxpe4 T A 9: 48,393,340 C242* probably null Het
Oas1b A T 5: 120,817,640 N162I probably damaging Het
Olfr1191-ps1 A G 2: 88,643,210 I148V probably benign Het
Otog A G 7: 46,267,276 N879S probably damaging Het
Park2 A G 17: 11,434,614 D199G probably benign Het
Pcsk7 T A 9: 45,927,625 Y612N probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pgbd5 T C 8: 124,434,011 D39G probably benign Het
Pkhd1l1 C T 15: 44,505,185 Q800* probably null Het
Pkn3 T C 2: 30,087,110 S621P probably benign Het
Polr3c T C 3: 96,715,185 I385V probably benign Het
Pxylp1 C T 9: 96,856,367 probably null Het
Rasgrp1 T C 2: 117,286,108 T613A probably benign Het
Robo3 C T 9: 37,425,378 V387I probably benign Het
Rxfp2 T A 5: 150,049,581 Y174N possibly damaging Het
Sec24a T C 11: 51,713,552 M746V probably damaging Het
Sema4f T A 6: 82,914,374 E571D possibly damaging Het
Sept3 T C 15: 82,286,456 V217A probably benign Het
Serpinb1b A C 13: 33,093,565 K260N probably benign Het
Sin3b A G 8: 72,749,872 T645A possibly damaging Het
Sobp C T 10: 43,021,834 R585Q probably damaging Het
Specc1l T A 10: 75,246,447 L559Q possibly damaging Het
Srxn1 C T 2: 152,105,653 probably benign Het
Sspo G A 6: 48,455,860 R890Q probably benign Het
Stard9 A G 2: 120,688,110 D505G probably damaging Het
Tjp1 A T 7: 65,322,339 I653K probably damaging Het
Tnks C T 8: 34,831,712 E1296K probably damaging Het
Ttbk2 A T 2: 120,748,640 I667N probably benign Het
Usp24 T C 4: 106,342,353 S165P possibly damaging Het
Usp46 T A 5: 74,028,937 K109* probably null Het
Vmn1r191 A G 13: 22,178,772 C271R probably benign Het
Wisp3 T A 10: 39,158,300 Y102F probably damaging Het
Zfp592 T C 7: 81,023,452 S55P probably damaging Het
Zmynd15 T C 11: 70,461,041 S158P probably benign Het
Zscan22 T G 7: 12,906,737 C303G probably damaging Het
Other mutations in Ppp1r21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01753:Ppp1r21 APN 17 88562102 splice site probably benign
IGL02366:Ppp1r21 APN 17 88547662 missense probably damaging 0.99
IGL02604:Ppp1r21 APN 17 88572743 missense probably benign 0.00
IGL02680:Ppp1r21 APN 17 88583862 missense probably benign 0.00
R0266:Ppp1r21 UTSW 17 88569072 splice site probably benign
R0436:Ppp1r21 UTSW 17 88565689 missense possibly damaging 0.96
R1398:Ppp1r21 UTSW 17 88542879 missense probably damaging 1.00
R1472:Ppp1r21 UTSW 17 88558605 missense probably damaging 1.00
R1599:Ppp1r21 UTSW 17 88572627 missense probably benign 0.00
R1677:Ppp1r21 UTSW 17 88550669 missense probably benign 0.04
R1760:Ppp1r21 UTSW 17 88562225 missense possibly damaging 0.78
R2571:Ppp1r21 UTSW 17 88545382 missense probably benign 0.06
R3700:Ppp1r21 UTSW 17 88582454 missense possibly damaging 0.88
R3786:Ppp1r21 UTSW 17 88577127 splice site probably null
R3959:Ppp1r21 UTSW 17 88549816 missense probably damaging 1.00
R4649:Ppp1r21 UTSW 17 88549513 missense probably benign
R4654:Ppp1r21 UTSW 17 88558799 missense probably benign 0.01
R4724:Ppp1r21 UTSW 17 88555591 nonsense probably null
R4766:Ppp1r21 UTSW 17 88572615 missense probably benign 0.00
R4933:Ppp1r21 UTSW 17 88547621 missense probably benign 0.07
R4934:Ppp1r21 UTSW 17 88545375 missense probably damaging 1.00
R4934:Ppp1r21 UTSW 17 88545376 missense probably damaging 0.98
R4992:Ppp1r21 UTSW 17 88569080 missense probably benign 0.44
R5109:Ppp1r21 UTSW 17 88558840 missense probably damaging 1.00
R5372:Ppp1r21 UTSW 17 88550675 missense probably benign 0.21
R5861:Ppp1r21 UTSW 17 88582509 missense probably damaging 1.00
R6200:Ppp1r21 UTSW 17 88569185 missense possibly damaging 0.65
R6369:Ppp1r21 UTSW 17 88582412 splice site probably null
R7060:Ppp1r21 UTSW 17 88580544 missense probably damaging 1.00
R7154:Ppp1r21 UTSW 17 88554886 missense probably damaging 0.99
R7390:Ppp1r21 UTSW 17 88549530 missense probably benign 0.26
R7470:Ppp1r21 UTSW 17 88562221 missense probably damaging 1.00
R7657:Ppp1r21 UTSW 17 88555682 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAATTGAGTTATGGGATGTCTTCCT -3'
(R):5'- GAGTCCCTATTTGTTGTCCCCA -3'

Sequencing Primer
(F):5'- TCTTCCTTTTTGAGGCAGGC -3'
(R):5'- CCCATTTGTCCAGGGCAAC -3'
Posted On2019-10-07