Incidental Mutation 'R7475:Map3k2'
ID 579455
Institutional Source Beutler Lab
Gene Symbol Map3k2
Ensembl Gene ENSMUSG00000024383
Gene Name mitogen-activated protein kinase kinase kinase 2
Synonyms 9630061B06Rik, MEK kinase 2, Mekk2
MMRRC Submission 045549-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7475 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 32296142-32369804 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 32333015 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 63 (V63A)
Ref Sequence ENSEMBL: ENSMUSP00000094326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096575]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000096575
AA Change: V63A

PolyPhen 2 Score 0.608 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000094326
Gene: ENSMUSG00000024383
AA Change: V63A

DomainStartEndE-ValueType
PB1 43 122 6.96e-20 SMART
low complexity region 203 219 N/A INTRINSIC
low complexity region 300 315 N/A INTRINSIC
low complexity region 322 334 N/A INTRINSIC
S_TKc 356 616 2.86e-92 SMART
Meta Mutation Damage Score 0.6436 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of serine/threonine protein kinase family. This kinase preferentially activates other kinases involved in the MAP kinase signaling pathway. This kinase has been shown to directly phosphorylate and activate Ikappa B kinases, and thus plays a role in NF-kappa B signaling pathway. This kinase has also been found to bind and activate protein kinase C-related kinase 2, which suggests its involvement in a regulated signaling process. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are grossly normal and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G T 16: 20,218,739 (GRCm39) N214K probably benign Het
Abcf1 A G 17: 36,274,459 (GRCm39) probably null Het
Agxt2 A T 15: 10,409,623 (GRCm39) M508L probably benign Het
Akr1c21 A T 13: 4,626,318 (GRCm39) Y114F probably benign Het
Amz1 T C 5: 140,729,941 (GRCm39) probably null Het
Ank1 G T 8: 23,622,646 (GRCm39) A1732S probably benign Het
Atg16l1 T C 1: 87,687,805 (GRCm39) S50P possibly damaging Het
AW551984 A G 9: 39,509,236 (GRCm39) S302P probably damaging Het
Ccn6 T A 10: 39,034,296 (GRCm39) Y102F probably damaging Het
Ces3a T A 8: 105,780,322 (GRCm39) probably null Het
Dedd C A 1: 171,167,881 (GRCm39) P185Q probably benign Het
Fam186a A T 15: 99,845,395 (GRCm39) V283E unknown Het
Fat2 C A 11: 55,194,479 (GRCm39) V1187F probably benign Het
Fbxw11 T C 11: 32,661,999 (GRCm39) probably null Het
Fcgbp C T 7: 27,802,401 (GRCm39) T1443I probably damaging Het
Foxj2 A G 6: 122,814,801 (GRCm39) D279G probably benign Het
Gbp5 A G 3: 142,207,122 (GRCm39) D97G probably damaging Het
Gm49368 A T 7: 127,707,154 (GRCm39) T661S possibly damaging Het
Gria4 T G 9: 4,513,330 (GRCm39) T260P probably damaging Het
Gtf2ird2 T A 5: 134,230,267 (GRCm39) D195E possibly damaging Het
Hectd4 T A 5: 121,496,196 (GRCm39) probably null Het
Ifngr2 G A 16: 91,354,797 (GRCm39) C32Y unknown Het
Ikzf5 A T 7: 130,993,788 (GRCm39) C280S probably benign Het
Ints9 G T 14: 65,263,914 (GRCm39) E395D probably null Het
Isoc2b T C 7: 4,854,084 (GRCm39) D96G probably benign Het
Jmjd1c T G 10: 67,061,092 (GRCm39) S967R probably benign Het
Kcnj3 A T 2: 55,327,338 (GRCm39) K42N probably benign Het
Kiz T C 2: 146,733,006 (GRCm39) V394A possibly damaging Het
Knl1 A T 2: 118,918,027 (GRCm39) H1795L probably damaging Het
Lmntd2 A G 7: 140,790,602 (GRCm39) probably null Het
Loxhd1 C A 18: 77,500,001 (GRCm39) D1690E possibly damaging Het
Lrp1b T C 2: 41,234,588 (GRCm39) D1121G Het
Mcc G T 18: 44,609,303 (GRCm39) A499D probably damaging Het
Mcpt9 T A 14: 56,264,400 (GRCm39) I232F probably damaging Het
Meltf A G 16: 31,700,756 (GRCm39) K92R probably benign Het
Mff T A 1: 82,723,159 (GRCm39) probably null Het
Mrgpra3 T A 7: 47,239,695 (GRCm39) Y77F probably damaging Het
Mylk G A 16: 34,734,446 (GRCm39) probably null Het
Ndufv2 A G 17: 66,394,532 (GRCm39) V111A possibly damaging Het
Nkd2 T C 13: 73,973,861 (GRCm39) E99G probably damaging Het
Nlk C A 11: 78,474,225 (GRCm39) G358V probably damaging Het
Nnmt A T 9: 48,503,532 (GRCm39) C165S probably damaging Het
Nxpe4 T A 9: 48,304,640 (GRCm39) C242* probably null Het
Oas1b A T 5: 120,955,705 (GRCm39) N162I probably damaging Het
Or4s2 A G 2: 88,473,554 (GRCm39) I148V probably benign Het
Otog A G 7: 45,916,700 (GRCm39) N879S probably damaging Het
Pcsk7 T A 9: 45,838,923 (GRCm39) Y612N probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Pgbd5 T C 8: 125,160,750 (GRCm39) D39G probably benign Het
Pkhd1l1 C T 15: 44,368,581 (GRCm39) Q800* probably null Het
Pkn3 T C 2: 29,977,122 (GRCm39) S621P probably benign Het
Polr3c T C 3: 96,622,501 (GRCm39) I385V probably benign Het
Ppp1r21 G T 17: 88,863,031 (GRCm39) G257W probably benign Het
Prkn A G 17: 11,653,501 (GRCm39) D199G probably benign Het
Pxylp1 C T 9: 96,738,420 (GRCm39) probably null Het
Rasgrp1 T C 2: 117,116,589 (GRCm39) T613A probably benign Het
Robo3 C T 9: 37,336,674 (GRCm39) V387I probably benign Het
Rxfp2 T A 5: 149,973,046 (GRCm39) Y174N possibly damaging Het
Sec24a T C 11: 51,604,379 (GRCm39) M746V probably damaging Het
Sema4f T A 6: 82,891,355 (GRCm39) E571D possibly damaging Het
Septin3 T C 15: 82,170,657 (GRCm39) V217A probably benign Het
Serpinb1b A C 13: 33,277,548 (GRCm39) K260N probably benign Het
Sin3b A G 8: 73,476,500 (GRCm39) T645A possibly damaging Het
Sobp C T 10: 42,897,830 (GRCm39) R585Q probably damaging Het
Specc1l T A 10: 75,082,281 (GRCm39) L559Q possibly damaging Het
Srxn1 C T 2: 151,947,573 (GRCm39) probably benign Het
Sspo G A 6: 48,432,794 (GRCm39) R890Q probably benign Het
Stard9 A G 2: 120,518,591 (GRCm39) D505G probably damaging Het
Tjp1 A T 7: 64,972,087 (GRCm39) I653K probably damaging Het
Tnks C T 8: 35,298,866 (GRCm39) E1296K probably damaging Het
Ttbk2 A T 2: 120,579,121 (GRCm39) I667N probably benign Het
Usp24 T C 4: 106,199,550 (GRCm39) S165P possibly damaging Het
Usp46 T A 5: 74,189,598 (GRCm39) K109* probably null Het
Vmn1r191 A G 13: 22,362,942 (GRCm39) C271R probably benign Het
Zfp592 T C 7: 80,673,200 (GRCm39) S55P probably damaging Het
Zmynd15 T C 11: 70,351,867 (GRCm39) S158P probably benign Het
Zscan22 T G 7: 12,640,664 (GRCm39) C303G probably damaging Het
Other mutations in Map3k2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:Map3k2 APN 18 32,361,292 (GRCm39) missense probably benign 0.00
IGL00774:Map3k2 APN 18 32,361,292 (GRCm39) missense probably benign 0.00
IGL01993:Map3k2 APN 18 32,359,684 (GRCm39) nonsense probably null
IGL02043:Map3k2 APN 18 32,340,587 (GRCm39) missense probably damaging 1.00
IGL02314:Map3k2 APN 18 32,351,553 (GRCm39) splice site probably benign
IGL02441:Map3k2 APN 18 32,333,099 (GRCm39) splice site probably benign
IGL03350:Map3k2 APN 18 32,345,201 (GRCm39) missense probably damaging 0.98
IGL03097:Map3k2 UTSW 18 32,333,070 (GRCm39) missense probably benign 0.01
PIT4434001:Map3k2 UTSW 18 32,343,088 (GRCm39) missense possibly damaging 0.51
R0086:Map3k2 UTSW 18 32,351,521 (GRCm39) missense probably damaging 1.00
R0374:Map3k2 UTSW 18 32,345,226 (GRCm39) splice site probably null
R0445:Map3k2 UTSW 18 32,350,263 (GRCm39) missense probably damaging 0.96
R1158:Map3k2 UTSW 18 32,350,211 (GRCm39) missense probably benign 0.00
R1415:Map3k2 UTSW 18 32,361,330 (GRCm39) missense possibly damaging 0.82
R1667:Map3k2 UTSW 18 32,336,845 (GRCm39) splice site probably benign
R1926:Map3k2 UTSW 18 32,336,163 (GRCm39) missense probably damaging 0.99
R3795:Map3k2 UTSW 18 32,359,701 (GRCm39) missense probably benign 0.00
R4607:Map3k2 UTSW 18 32,333,030 (GRCm39) missense probably damaging 1.00
R4793:Map3k2 UTSW 18 32,361,203 (GRCm39) missense probably damaging 1.00
R5332:Map3k2 UTSW 18 32,340,509 (GRCm39) missense probably damaging 0.98
R5492:Map3k2 UTSW 18 32,361,189 (GRCm39) missense probably damaging 1.00
R6008:Map3k2 UTSW 18 32,336,104 (GRCm39) missense probably damaging 1.00
R6317:Map3k2 UTSW 18 32,336,086 (GRCm39) missense probably damaging 1.00
R6356:Map3k2 UTSW 18 32,345,023 (GRCm39) missense probably damaging 1.00
R6841:Map3k2 UTSW 18 32,359,682 (GRCm39) missense probably benign 0.12
R6928:Map3k2 UTSW 18 32,340,593 (GRCm39) critical splice donor site probably null
R7696:Map3k2 UTSW 18 32,353,647 (GRCm39) missense probably benign 0.00
R8774:Map3k2 UTSW 18 32,345,117 (GRCm39) missense probably damaging 1.00
R8774-TAIL:Map3k2 UTSW 18 32,345,117 (GRCm39) missense probably damaging 1.00
R9103:Map3k2 UTSW 18 32,353,625 (GRCm39) missense possibly damaging 0.91
R9282:Map3k2 UTSW 18 32,342,805 (GRCm39) missense probably damaging 0.99
R9800:Map3k2 UTSW 18 32,333,069 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GCAGTCTATTACACACATGCACAG -3'
(R):5'- TGTGCATCTCACTCCTATAATGTAC -3'

Sequencing Primer
(F):5'- GATTTAAACACTCTCCTAAGTAGCAC -3'
(R):5'- GGACTACTAAAAATAGTATGCGT -3'
Posted On 2019-10-07