Incidental Mutation 'R7476:Stk35'
ID 579469
Institutional Source Beutler Lab
Gene Symbol Stk35
Ensembl Gene ENSMUSG00000037885
Gene Name serine/threonine kinase 35
Synonyms 1700054C12Rik, CLIK1, CLP-36 interacting kinase
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7476 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 129800517-129832287 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 129810725 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 382 (L382P)
Ref Sequence ENSEMBL: ENSMUSP00000126541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165413] [ENSMUST00000166282]
AlphaFold Q80ZW0
Predicted Effect probably damaging
Transcript: ENSMUST00000165413
AA Change: L382P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126541
Gene: ENSMUSG00000037885
AA Change: L382P

DomainStartEndE-ValueType
low complexity region 51 69 N/A INTRINSIC
low complexity region 115 137 N/A INTRINSIC
low complexity region 190 206 N/A INTRINSIC
Pfam:Pkinase_Tyr 207 295 2e-6 PFAM
Pfam:Pkinase 207 531 8.6e-51 PFAM
Pfam:Pkinase_Tyr 304 532 2.1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166282
SMART Domains Protein: ENSMUSP00000132862
Gene: ENSMUSG00000037885

DomainStartEndE-ValueType
low complexity region 51 69 N/A INTRINSIC
low complexity region 115 137 N/A INTRINSIC
low complexity region 190 206 N/A INTRINSIC
Pfam:Pkinase_Tyr 207 300 5.9e-7 PFAM
Pfam:Pkinase 207 311 1e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kinase that is predominantly found in the nucleus. However, it can interact with PDLIM1/CLP-36 in the cytoplasm and localize to actin stress fibers. The encoded protein may be a regulator of actin stress fibers in nonmuscle cells. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik C T 6: 52,179,034 P27S unknown Het
Abi3bp A T 16: 56,614,746 K602* probably null Het
Adam29 G T 8: 55,873,195 H75N probably damaging Het
Ajap1 C T 4: 153,384,855 E373K probably damaging Het
Alg6 C A 4: 99,743,876 H206N probably damaging Het
Alox5 A T 6: 116,415,433 S376T probably benign Het
Arhgap19 A T 19: 41,782,363 Y321N probably benign Het
Brip1 A G 11: 86,157,808 V236A probably benign Het
C1ra C T 6: 124,522,699 P615S probably damaging Het
Ccdc69 C T 11: 55,051,198 V161I possibly damaging Het
Chil5 G A 3: 106,020,007 R163C possibly damaging Het
Cldnd1 A G 16: 58,729,544 D30G probably damaging Het
Colca2 G A 9: 51,277,600 A19V possibly damaging Het
Csmd1 A G 8: 15,895,731 C3561R probably damaging Het
Daxx T G 17: 33,911,281 V90G probably damaging Het
Dgkg T A 16: 22,622,304 probably benign Het
Dmrta2 A G 4: 109,982,025 H323R probably damaging Het
Dysf A T 6: 84,064,896 T161S probably benign Het
Fat1 G T 8: 45,031,274 R3183L probably benign Het
Fcho1 C A 8: 71,713,546 D347Y probably damaging Het
Gm21798 T C 15: 64,817,706 C5R unknown Het
Hmcn1 T C 1: 150,580,267 R5301G probably damaging Het
Hoxd11 T C 2: 74,684,115 F330L probably damaging Het
Lactbl1 A G 4: 136,637,639 D434G probably benign Het
Lgals8 A T 13: 12,448,481 N191K probably damaging Het
Lmod2 T A 6: 24,597,921 Y13* probably null Het
Malrd1 T C 2: 16,142,304 S1986P unknown Het
Map3k9 C T 12: 81,743,808 D324N probably damaging Het
Mcmbp C A 7: 128,703,582 K487N probably damaging Het
Mrpl4 G T 9: 21,002,771 probably benign Het
Nectin2 T C 7: 19,717,621 D496G possibly damaging Het
Nom1 T C 5: 29,442,536 S590P probably benign Het
Noto T C 6: 85,425,499 F156L probably damaging Het
Nrf1 T A 6: 30,116,272 D314E probably damaging Het
Nup93 T C 8: 94,303,632 L373P probably damaging Het
Olfr1002 T A 2: 85,648,168 Q51L not run Het
Olfr1168 A T 2: 88,184,966 M30L probably benign Het
Olfr1205 A G 2: 88,831,588 Q157R probably benign Het
Olfr1239 T C 2: 89,417,499 K305E possibly damaging Het
Olfr1369-ps1 A C 13: 21,116,021 I110L probably benign Het
Olfr1412 A C 1: 92,589,264 R311S probably benign Het
Pclo A T 5: 14,521,331 K243N probably damaging Het
Pdgfra T A 5: 75,170,603 C290S probably damaging Het
Pnlip G A 19: 58,679,634 probably null Het
Ptprm A T 17: 66,725,791 H1022Q probably benign Het
Rfx2 T C 17: 56,803,527 D153G probably benign Het
Rps6ka2 T C 17: 7,271,633 F317L probably damaging Het
Rtl1 T A 12: 109,591,105 E1433D unknown Het
Sarnp A G 10: 128,833,354 T27A probably benign Het
Shc3 A T 13: 51,448,006 M295K probably benign Het
Slc1a3 T A 15: 8,643,084 M304L probably damaging Het
Slco1a6 G T 6: 142,103,001 T351K possibly damaging Het
Snrk A G 9: 122,157,222 N219S probably damaging Het
Spats2 T A 15: 99,212,141 V473E probably benign Het
Tbx10 T C 19: 3,999,034 V315A probably benign Het
Tdpoz1 A G 3: 93,670,775 L234P probably damaging Het
Ttn T G 2: 76,714,145 E32832D probably benign Het
Ttn T C 2: 76,771,186 Y18678C probably damaging Het
Ugt2a2 A T 5: 87,474,494 M205K probably damaging Het
Utrn C A 10: 12,640,951 V2300L probably benign Het
Vmn1r175 T C 7: 23,808,422 N260S probably benign Het
Vmn1r63 T A 7: 5,803,001 I211L probably benign Het
Vmn1r83 A G 7: 12,321,615 W172R possibly damaging Het
Xirp2 T C 2: 67,510,634 L1073P probably benign Het
Zfp82 A G 7: 30,056,172 V495A possibly damaging Het
Other mutations in Stk35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Stk35 APN 2 129801992 missense probably damaging 1.00
IGL02609:Stk35 APN 2 129801801 missense probably damaging 1.00
fingernails UTSW 2 129810935 missense probably damaging 1.00
R2256_Stk35_331 UTSW 2 129810507 nonsense probably null
skinned UTSW 2 129811235 intron probably benign
R0045:Stk35 UTSW 2 129800568 nonsense probably null
R0306:Stk35 UTSW 2 129801763 nonsense probably null
R0784:Stk35 UTSW 2 129810802 nonsense probably null
R1536:Stk35 UTSW 2 129811235 intron probably benign
R2256:Stk35 UTSW 2 129810507 nonsense probably null
R2507:Stk35 UTSW 2 129801515 missense probably damaging 0.97
R2508:Stk35 UTSW 2 129801515 missense probably damaging 0.97
R3848:Stk35 UTSW 2 129800736 missense probably benign 0.13
R3872:Stk35 UTSW 2 129810575 missense possibly damaging 0.82
R4466:Stk35 UTSW 2 129801516 missense probably damaging 0.99
R5144:Stk35 UTSW 2 129810935 missense probably damaging 1.00
R6267:Stk35 UTSW 2 129810888 nonsense probably null
R6296:Stk35 UTSW 2 129810888 nonsense probably null
R6480:Stk35 UTSW 2 129810687 missense possibly damaging 0.95
R6807:Stk35 UTSW 2 129801653 missense probably damaging 0.97
R7203:Stk35 UTSW 2 129801593 missense probably benign
R8505:Stk35 UTSW 2 129801729 missense probably damaging 0.99
R8998:Stk35 UTSW 2 129810589 missense probably damaging 1.00
R8999:Stk35 UTSW 2 129810589 missense probably damaging 1.00
R9224:Stk35 UTSW 2 129810571 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGATCCTGGGCTATGCTGAG -3'
(R):5'- GCCTTGGCTGTATAGTGTCC -3'

Sequencing Primer
(F):5'- TATGCTGAGGAGCCCTGCTATC -3'
(R):5'- GGCTGTATAGTGTCCCTCCCAG -3'
Posted On 2019-10-07