Incidental Mutation 'R7476:Adam29'
ID 579496
Institutional Source Beutler Lab
Gene Symbol Adam29
Ensembl Gene ENSMUSG00000046258
Gene Name a disintegrin and metallopeptidase domain 29
Synonyms
MMRRC Submission 045550-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.065) question?
Stock # R7476 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 56323947-56359983 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 56326230 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 75 (H75N)
Ref Sequence ENSEMBL: ENSMUSP00000054292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053441]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000053441
AA Change: H75N

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000054292
Gene: ENSMUSG00000046258
AA Change: H75N

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Pep_M12B_propep 33 159 1.9e-17 PFAM
Pfam:Reprolysin_4 203 394 3.3e-10 PFAM
Pfam:Reprolysin_5 203 403 6.9e-15 PFAM
Pfam:Reprolysin 205 395 1.5e-48 PFAM
Pfam:Reprolysin_2 226 386 7.4e-11 PFAM
Pfam:Reprolysin_3 228 349 1.4e-11 PFAM
DISIN 412 487 4.26e-37 SMART
ACR 488 624 2.85e-58 SMART
low complexity region 642 651 N/A INTRINSIC
transmembrane domain 683 705 N/A INTRINSIC
low complexity region 713 746 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. [provided by RefSeq, May 2016]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik C T 6: 52,156,014 (GRCm39) P27S unknown Het
Abi3bp A T 16: 56,435,109 (GRCm39) K602* probably null Het
Ajap1 C T 4: 153,469,312 (GRCm39) E373K probably damaging Het
Alg6 C A 4: 99,632,113 (GRCm39) H206N probably damaging Het
Alox5 A T 6: 116,392,394 (GRCm39) S376T probably benign Het
Arhgap19 A T 19: 41,770,802 (GRCm39) Y321N probably benign Het
Brip1 A G 11: 86,048,634 (GRCm39) V236A probably benign Het
C1ra C T 6: 124,499,658 (GRCm39) P615S probably damaging Het
Ccdc69 C T 11: 54,942,024 (GRCm39) V161I possibly damaging Het
Chil5 G A 3: 105,927,323 (GRCm39) R163C possibly damaging Het
Cldnd1 A G 16: 58,549,907 (GRCm39) D30G probably damaging Het
Csmd1 A G 8: 15,945,731 (GRCm39) C3561R probably damaging Het
Daxx T G 17: 34,130,255 (GRCm39) V90G probably damaging Het
Dgkg T A 16: 22,441,054 (GRCm39) probably benign Het
Dmrta2 A G 4: 109,839,222 (GRCm39) H323R probably damaging Het
Dysf A T 6: 84,041,878 (GRCm39) T161S probably benign Het
Fat1 G T 8: 45,484,311 (GRCm39) R3183L probably benign Het
Fcho1 C A 8: 72,166,190 (GRCm39) D347Y probably damaging Het
Gm21798 T C 15: 64,689,555 (GRCm39) C5R unknown Het
Hmcn1 T C 1: 150,456,018 (GRCm39) R5301G probably damaging Het
Hoxd11 T C 2: 74,514,459 (GRCm39) F330L probably damaging Het
Lactbl1 A G 4: 136,364,950 (GRCm39) D434G probably benign Het
Lgals8 A T 13: 12,463,362 (GRCm39) N191K probably damaging Het
Lmod2 T A 6: 24,597,920 (GRCm39) Y13* probably null Het
Malrd1 T C 2: 16,147,115 (GRCm39) S1986P unknown Het
Map3k9 C T 12: 81,790,582 (GRCm39) D324N probably damaging Het
Mcmbp C A 7: 128,305,306 (GRCm39) K487N probably damaging Het
Mrpl4 G T 9: 20,914,067 (GRCm39) probably benign Het
Nectin2 T C 7: 19,451,546 (GRCm39) D496G possibly damaging Het
Nom1 T C 5: 29,647,534 (GRCm39) S590P probably benign Het
Noto T C 6: 85,402,481 (GRCm39) F156L probably damaging Het
Nrf1 T A 6: 30,116,271 (GRCm39) D314E probably damaging Het
Nup93 T C 8: 95,030,260 (GRCm39) L373P probably damaging Het
Or2w1b A C 13: 21,300,191 (GRCm39) I110L probably benign Het
Or4a2 T C 2: 89,247,843 (GRCm39) K305E possibly damaging Het
Or4c11c A G 2: 88,661,932 (GRCm39) Q157R probably benign Het
Or5d40 A T 2: 88,015,310 (GRCm39) M30L probably benign Het
Or5g25 T A 2: 85,478,512 (GRCm39) Q51L not run Het
Or9s27 A C 1: 92,516,986 (GRCm39) R311S probably benign Het
Pclo A T 5: 14,571,345 (GRCm39) K243N probably damaging Het
Pdgfra T A 5: 75,331,264 (GRCm39) C290S probably damaging Het
Pnlip G A 19: 58,668,066 (GRCm39) probably null Het
Pou2af3 G A 9: 51,188,900 (GRCm39) A19V possibly damaging Het
Ptprm A T 17: 67,032,786 (GRCm39) H1022Q probably benign Het
Rfx2 T C 17: 57,110,527 (GRCm39) D153G probably benign Het
Rps6ka2 T C 17: 7,539,032 (GRCm39) F317L probably damaging Het
Rtl1 T A 12: 109,557,539 (GRCm39) E1433D unknown Het
Sarnp A G 10: 128,669,223 (GRCm39) T27A probably benign Het
Shc3 A T 13: 51,602,042 (GRCm39) M295K probably benign Het
Slc1a3 T A 15: 8,672,568 (GRCm39) M304L probably damaging Het
Slco1a6 G T 6: 142,048,727 (GRCm39) T351K possibly damaging Het
Snrk A G 9: 121,986,288 (GRCm39) N219S probably damaging Het
Spats2 T A 15: 99,110,022 (GRCm39) V473E probably benign Het
Stk35 T C 2: 129,652,645 (GRCm39) L382P probably damaging Het
Tbx10 T C 19: 4,049,034 (GRCm39) V315A probably benign Het
Tdpoz1 A G 3: 93,578,082 (GRCm39) L234P probably damaging Het
Ttn T G 2: 76,544,489 (GRCm39) E32832D probably benign Het
Ttn T C 2: 76,601,530 (GRCm39) Y18678C probably damaging Het
Ugt2a2 A T 5: 87,622,353 (GRCm39) M205K probably damaging Het
Utrn C A 10: 12,516,695 (GRCm39) V2300L probably benign Het
Vmn1r175 T C 7: 23,507,847 (GRCm39) N260S probably benign Het
Vmn1r63 T A 7: 5,806,000 (GRCm39) I211L probably benign Het
Vmn1r83 A G 7: 12,055,542 (GRCm39) W172R possibly damaging Het
Xirp2 T C 2: 67,340,978 (GRCm39) L1073P probably benign Het
Zfp82 A G 7: 29,755,597 (GRCm39) V495A possibly damaging Het
Other mutations in Adam29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Adam29 APN 8 56,324,879 (GRCm39) missense probably benign 0.01
IGL01406:Adam29 APN 8 56,324,874 (GRCm39) missense probably damaging 1.00
IGL01511:Adam29 APN 8 56,324,456 (GRCm39) missense probably damaging 1.00
IGL01869:Adam29 APN 8 56,324,732 (GRCm39) missense probably damaging 0.99
IGL01894:Adam29 APN 8 56,324,865 (GRCm39) missense probably benign 0.00
IGL02023:Adam29 APN 8 56,325,519 (GRCm39) missense probably benign 0.12
IGL02030:Adam29 APN 8 56,325,157 (GRCm39) missense probably benign 0.35
IGL02071:Adam29 APN 8 56,324,589 (GRCm39) missense possibly damaging 0.95
IGL02094:Adam29 APN 8 56,324,480 (GRCm39) missense possibly damaging 0.48
IGL02108:Adam29 APN 8 56,325,346 (GRCm39) missense probably damaging 0.98
IGL02125:Adam29 APN 8 56,324,974 (GRCm39) nonsense probably null
IGL02330:Adam29 APN 8 56,325,398 (GRCm39) missense probably benign 0.02
IGL02332:Adam29 APN 8 56,324,775 (GRCm39) missense probably damaging 1.00
IGL02548:Adam29 APN 8 56,325,902 (GRCm39) nonsense probably null
IGL02960:Adam29 APN 8 56,325,701 (GRCm39) nonsense probably null
IGL03030:Adam29 APN 8 56,326,100 (GRCm39) missense probably damaging 1.00
ANU22:Adam29 UTSW 8 56,324,879 (GRCm39) missense probably benign 0.01
D4043:Adam29 UTSW 8 56,325,496 (GRCm39) nonsense probably null
IGL02835:Adam29 UTSW 8 56,326,173 (GRCm39) missense probably damaging 1.00
R0294:Adam29 UTSW 8 56,326,311 (GRCm39) missense probably benign 0.25
R0449:Adam29 UTSW 8 56,325,716 (GRCm39) missense probably benign 0.01
R0607:Adam29 UTSW 8 56,326,310 (GRCm39) missense probably damaging 1.00
R0626:Adam29 UTSW 8 56,324,612 (GRCm39) missense probably benign 0.24
R1296:Adam29 UTSW 8 56,324,754 (GRCm39) nonsense probably null
R1752:Adam29 UTSW 8 56,325,309 (GRCm39) missense probably damaging 0.98
R1930:Adam29 UTSW 8 56,326,124 (GRCm39) missense probably damaging 1.00
R1931:Adam29 UTSW 8 56,326,124 (GRCm39) missense probably damaging 1.00
R2397:Adam29 UTSW 8 56,325,933 (GRCm39) missense probably benign 0.04
R2764:Adam29 UTSW 8 56,324,791 (GRCm39) missense probably damaging 1.00
R4052:Adam29 UTSW 8 56,325,317 (GRCm39) missense probably damaging 1.00
R4978:Adam29 UTSW 8 56,324,436 (GRCm39) missense probably damaging 0.98
R5306:Adam29 UTSW 8 56,324,792 (GRCm39) missense probably damaging 1.00
R6383:Adam29 UTSW 8 56,324,543 (GRCm39) missense probably damaging 0.99
R6528:Adam29 UTSW 8 56,325,596 (GRCm39) missense possibly damaging 0.93
R6579:Adam29 UTSW 8 56,325,779 (GRCm39) missense probably damaging 1.00
R6707:Adam29 UTSW 8 56,325,135 (GRCm39) missense probably damaging 1.00
R7076:Adam29 UTSW 8 56,324,694 (GRCm39) missense probably damaging 1.00
R7099:Adam29 UTSW 8 56,324,439 (GRCm39) missense probably benign 0.01
R7177:Adam29 UTSW 8 56,325,659 (GRCm39) missense probably benign 0.30
R7320:Adam29 UTSW 8 56,325,749 (GRCm39) missense possibly damaging 0.50
R7420:Adam29 UTSW 8 56,325,933 (GRCm39) missense probably benign 0.04
R7438:Adam29 UTSW 8 56,324,609 (GRCm39) missense probably damaging 0.99
R7524:Adam29 UTSW 8 56,325,395 (GRCm39) missense probably damaging 1.00
R8066:Adam29 UTSW 8 56,325,703 (GRCm39) missense probably benign 0.11
R8111:Adam29 UTSW 8 56,324,585 (GRCm39) missense probably benign 0.00
R8221:Adam29 UTSW 8 56,325,463 (GRCm39) missense probably benign 0.02
R8350:Adam29 UTSW 8 56,325,224 (GRCm39) missense possibly damaging 0.89
R8353:Adam29 UTSW 8 56,326,196 (GRCm39) missense possibly damaging 0.82
R8453:Adam29 UTSW 8 56,326,196 (GRCm39) missense possibly damaging 0.82
R8723:Adam29 UTSW 8 56,324,513 (GRCm39) missense probably damaging 1.00
R8752:Adam29 UTSW 8 56,325,328 (GRCm39) nonsense probably null
R8809:Adam29 UTSW 8 56,325,659 (GRCm39) missense probably benign 0.30
R9025:Adam29 UTSW 8 56,325,196 (GRCm39) nonsense probably null
R9388:Adam29 UTSW 8 56,325,285 (GRCm39) missense probably damaging 1.00
R9612:Adam29 UTSW 8 56,325,118 (GRCm39) missense possibly damaging 0.77
X0011:Adam29 UTSW 8 56,326,203 (GRCm39) missense probably benign 0.02
Z1177:Adam29 UTSW 8 56,324,531 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGGAACCCCTTGATTCTG -3'
(R):5'- GACACAAGTGTTTGGGATTTTCC -3'

Sequencing Primer
(F):5'- ACTGTCCACTTTATAGACCAGATG -3'
(R):5'- CTGTGTTTTCCTGGACTCACAAAGG -3'
Posted On 2019-10-07