Mutagenetix > Incidental Mutation

Incidental Mutation 'R7476:Nup93'

579498

Institutional Source

Beutler Lab

Gene Symbol

Nup93

Ensembl Gene

ENSMUSG00000032939

Gene Name

nucleoporin 93

Synonyms

2410008G02Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.912) question?

Stock #

R7476 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

94214564-94317227 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 94303632 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 373 (L373P)

Ref Sequence

ENSEMBL: ENSMUSP00000078878 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079961] [ENSMUST00000109547] [ENSMUST00000211822] [ENSMUST00000212824]

AlphaFold

Q8BJ71

Predicted Effect

probably damaging
Transcript: ENSMUST00000079961
AA Change: L373P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000078878
Gene: ENSMUSG00000032939
AA Change: L373P

Domain	Start	End	E-Value	Type
low complexity region	8	19	N/A	INTRINSIC
low complexity region	42	52	N/A	INTRINSIC
Pfam:Nic96	214	804	6.9e-198	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000109547
AA Change: L373P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000105174
Gene: ENSMUSG00000032939
AA Change: L373P

Domain	Start	End	E-Value	Type
low complexity region	8	19	N/A	INTRINSIC
low complexity region	42	52	N/A	INTRINSIC
Pfam:Nic96	202	804	8.2e-202	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000211822
AA Change: L250P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

Predicted Effect

probably damaging
Transcript: ENSMUST00000212824
AA Change: L373P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. This gene encodes a nucleoporin protein that localizes both to the basket of the pore and to the nuclear entry of the central gated channel of the pore. The encoded protein is a target of caspase cysteine proteases that play a central role in programmed cell death by apoptosis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730596B20Rik	C	T	6: 52,179,034	P27S	unknown	Het
Abi3bp	A	T	16: 56,614,746	K602*	probably null	Het
Adam29	G	T	8: 55,873,195	H75N	probably damaging	Het
Ajap1	C	T	4: 153,384,855	E373K	probably damaging	Het
Alg6	C	A	4: 99,743,876	H206N	probably damaging	Het
Alox5	A	T	6: 116,415,433	S376T	probably benign	Het
Arhgap19	A	T	19: 41,782,363	Y321N	probably benign	Het
Brip1	A	G	11: 86,157,808	V236A	probably benign	Het
C1ra	C	T	6: 124,522,699	P615S	probably damaging	Het
Ccdc69	C	T	11: 55,051,198	V161I	possibly damaging	Het
Chil5	G	A	3: 106,020,007	R163C	possibly damaging	Het
Cldnd1	A	G	16: 58,729,544	D30G	probably damaging	Het
Colca2	G	A	9: 51,277,600	A19V	possibly damaging	Het
Csmd1	A	G	8: 15,895,731	C3561R	probably damaging	Het
Daxx	T	G	17: 33,911,281	V90G	probably damaging	Het
Dgkg	T	A	16: 22,622,304		probably benign	Het
Dmrta2	A	G	4: 109,982,025	H323R	probably damaging	Het
Dysf	A	T	6: 84,064,896	T161S	probably benign	Het
Fat1	G	T	8: 45,031,274	R3183L	probably benign	Het
Fcho1	C	A	8: 71,713,546	D347Y	probably damaging	Het
Gm21798	T	C	15: 64,817,706	C5R	unknown	Het
Hmcn1	T	C	1: 150,580,267	R5301G	probably damaging	Het
Hoxd11	T	C	2: 74,684,115	F330L	probably damaging	Het
Lactbl1	A	G	4: 136,637,639	D434G	probably benign	Het
Lgals8	A	T	13: 12,448,481	N191K	probably damaging	Het
Lmod2	T	A	6: 24,597,921	Y13*	probably null	Het
Malrd1	T	C	2: 16,142,304	S1986P	unknown	Het
Map3k9	C	T	12: 81,743,808	D324N	probably damaging	Het
Mcmbp	C	A	7: 128,703,582	K487N	probably damaging	Het
Mrpl4	G	T	9: 21,002,771		probably benign	Het
Nectin2	T	C	7: 19,717,621	D496G	possibly damaging	Het
Nom1	T	C	5: 29,442,536	S590P	probably benign	Het
Noto	T	C	6: 85,425,499	F156L	probably damaging	Het
Nrf1	T	A	6: 30,116,272	D314E	probably damaging	Het
Olfr1002	T	A	2: 85,648,168	Q51L	not run	Het
Olfr1168	A	T	2: 88,184,966	M30L	probably benign	Het
Olfr1205	A	G	2: 88,831,588	Q157R	probably benign	Het
Olfr1239	T	C	2: 89,417,499	K305E	possibly damaging	Het
Olfr1369-ps1	A	C	13: 21,116,021	I110L	probably benign	Het
Olfr1412	A	C	1: 92,589,264	R311S	probably benign	Het
Pclo	A	T	5: 14,521,331	K243N	probably damaging	Het
Pdgfra	T	A	5: 75,170,603	C290S	probably damaging	Het
Pnlip	G	A	19: 58,679,634		probably null	Het
Ptprm	A	T	17: 66,725,791	H1022Q	probably benign	Het
Rfx2	T	C	17: 56,803,527	D153G	probably benign	Het
Rps6ka2	T	C	17: 7,271,633	F317L	probably damaging	Het
Rtl1	T	A	12: 109,591,105	E1433D	unknown	Het
Sarnp	A	G	10: 128,833,354	T27A	probably benign	Het
Shc3	A	T	13: 51,448,006	M295K	probably benign	Het
Slc1a3	T	A	15: 8,643,084	M304L	probably damaging	Het
Slco1a6	G	T	6: 142,103,001	T351K	possibly damaging	Het
Snrk	A	G	9: 122,157,222	N219S	probably damaging	Het
Spats2	T	A	15: 99,212,141	V473E	probably benign	Het
Stk35	T	C	2: 129,810,725	L382P	probably damaging	Het
Tbx10	T	C	19: 3,999,034	V315A	probably benign	Het
Tdpoz1	A	G	3: 93,670,775	L234P	probably damaging	Het
Ttn	T	G	2: 76,714,145	E32832D	probably benign	Het
Ttn	T	C	2: 76,771,186	Y18678C	probably damaging	Het
Ugt2a2	A	T	5: 87,474,494	M205K	probably damaging	Het
Utrn	C	A	10: 12,640,951	V2300L	probably benign	Het
Vmn1r175	T	C	7: 23,808,422	N260S	probably benign	Het
Vmn1r63	T	A	7: 5,803,001	I211L	probably benign	Het
Vmn1r83	A	G	7: 12,321,615	W172R	possibly damaging	Het
Xirp2	T	C	2: 67,510,634	L1073P	probably benign	Het
Zfp82	A	G	7: 30,056,172	V495A	possibly damaging	Het

Other mutations in Nup93

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00783:Nup93	APN	8	94309023	critical splice donor site	probably null
IGL01652:Nup93	APN	8	94296559	missense	possibly damaging	0.93
IGL02003:Nup93	APN	8	94302109	nonsense	probably null
IGL02169:Nup93	APN	8	94302129	missense	probably damaging	1.00
IGL02212:Nup93	APN	8	94311662	critical splice donor site	probably null
IGL02551:Nup93	APN	8	94227833	nonsense	probably null
IGL02568:Nup93	APN	8	94309635	missense	probably damaging	1.00
IGL03094:Nup93	APN	8	94296502	missense	probably benign
IGL03248:Nup93	APN	8	94306088	missense	probably damaging	0.98
IGL03273:Nup93	APN	8	94306277	missense	probably benign	0.01
IGL03401:Nup93	APN	8	94309711	splice site	probably null
PIT4585001:Nup93	UTSW	8	94243727	missense	probably benign	0.25
R0409:Nup93	UTSW	8	94303665	missense	probably damaging	1.00
R0748:Nup93	UTSW	8	94307943	missense	probably damaging	1.00
R0891:Nup93	UTSW	8	94281263	splice site	probably benign
R1667:Nup93	UTSW	8	94292687	missense	possibly damaging	0.71
R1696:Nup93	UTSW	8	94296555	missense	probably benign	0.29
R1862:Nup93	UTSW	8	94306102	missense	probably damaging	1.00
R2069:Nup93	UTSW	8	94243739	missense	probably damaging	1.00
R2143:Nup93	UTSW	8	94296480	nonsense	probably null
R2187:Nup93	UTSW	8	94300850	missense	probably damaging	1.00
R2228:Nup93	UTSW	8	94304191	missense	probably benign	0.27
R2229:Nup93	UTSW	8	94304191	missense	probably benign	0.27
R2254:Nup93	UTSW	8	94227857	critical splice donor site	probably null
R2884:Nup93	UTSW	8	94303638	missense	probably damaging	1.00
R4521:Nup93	UTSW	8	94314636	missense	probably damaging	1.00
R4563:Nup93	UTSW	8	94307892	missense	probably damaging	1.00
R4900:Nup93	UTSW	8	94286603	missense	probably benign	0.25
R5570:Nup93	UTSW	8	94314670	missense	probably damaging	1.00
R6226:Nup93	UTSW	8	94286537	missense	probably damaging	1.00
R6489:Nup93	UTSW	8	94302088	missense	probably benign	0.10
R6658:Nup93	UTSW	8	94304179	missense	probably benign	0.02
R6817:Nup93	UTSW	8	94314682	critical splice donor site	probably null
R6895:Nup93	UTSW	8	94243686	missense	probably damaging	1.00
R6955:Nup93	UTSW	8	94309673	missense	probably damaging	0.96
R7643:Nup93	UTSW	8	94286619	critical splice donor site	probably null
R7994:Nup93	UTSW	8	94306302	missense	probably benign	0.15
R8461:Nup93	UTSW	8	94281335	critical splice donor site	probably null
R9177:Nup93	UTSW	8	94227743	missense	probably benign	0.25
R9264:Nup93	UTSW	8	94292720	missense	probably benign	0.01
R9532:Nup93	UTSW	8	94314621	missense	probably damaging	1.00
R9567:Nup93	UTSW	8	94308976	missense	possibly damaging	0.94
R9629:Nup93	UTSW	8	94306639	missense	probably damaging	0.99
R9721:Nup93	UTSW	8	94303685	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCAGTCTTCCTAATGAGGTCTTAGAC -3'
(R):5'- TTGAGCATGGCGGACTTGAG -3'

Sequencing Primer
(F):5'- TGTAGTGCTAGCAATTAGAAGTCAG -3'
(R):5'- CTTGAGCAGCCAAAGGACACTG -3'

Posted On

2019-10-07