Incidental Mutation 'R7476:Rtl1'
ID579507
Institutional Source Beutler Lab
Gene Symbol Rtl1
Ensembl Gene ENSMUSG00000085925
Gene Nameretrotransposon Gaglike 1
SynonymsMart1, Mor1, Mar
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7476 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location109589193-109600330 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 109591105 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 1433 (E1433D)
Ref Sequence ENSEMBL: ENSMUSP00000115957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000149046]
Predicted Effect unknown
Transcript: ENSMUST00000149046
AA Change: E1433D
SMART Domains Protein: ENSMUSP00000115957
Gene: ENSMUSG00000085925
AA Change: E1433D

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
low complexity region 41 80 N/A INTRINSIC
internal_repeat_1 88 163 8.8e-50 PROSPERO
internal_repeat_1 176 251 8.8e-50 PROSPERO
low complexity region 332 361 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
low complexity region 393 408 N/A INTRINSIC
Pfam:DUF4939 432 538 1.6e-14 PFAM
Pfam:Retrotrans_gag 493 586 9.2e-13 PFAM
low complexity region 611 632 N/A INTRINSIC
Pfam:gag-asp_proteas 663 731 2.3e-15 PFAM
low complexity region 833 849 N/A INTRINSIC
low complexity region 878 892 N/A INTRINSIC
PDB:4OL8|E 988 1192 6e-17 PDB
Blast:CYCc 989 1158 5e-9 BLAST
SCOP:d1sig__ 1291 1443 2e-4 SMART
low complexity region 1733 1744 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a retrotransposon-derived, paternally expressed imprinted gene that is highly expressed at the late fetal stage in both the fetus and placenta. It has an overlapping maternally expressed antisense transcript, which contains several microRNAs targeting the transcripts of this gene through an RNA interference (RNAi) mechanism. This gene is essential for maintenance of the fetal capillaries. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice heterozygous for a paternally inherited knock-out allele exhibit fetal/neonatal lethality associated with underdevelopment of the placenta. Mice heteroygous for a maternally inherited knock-out allele exhibit neonatal lethality and decreased survival associated with placental overdevelopment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik C T 6: 52,179,034 P27S unknown Het
Abi3bp A T 16: 56,614,746 K602* probably null Het
Adam29 G T 8: 55,873,195 H75N probably damaging Het
Ajap1 C T 4: 153,384,855 E373K probably damaging Het
Alg6 C A 4: 99,743,876 H206N probably damaging Het
Alox5 A T 6: 116,415,433 S376T probably benign Het
Arhgap19 A T 19: 41,782,363 Y321N probably benign Het
Brip1 A G 11: 86,157,808 V236A probably benign Het
C1ra C T 6: 124,522,699 P615S probably damaging Het
Ccdc69 C T 11: 55,051,198 V161I possibly damaging Het
Chil5 G A 3: 106,020,007 R163C possibly damaging Het
Cldnd1 A G 16: 58,729,544 D30G probably damaging Het
Colca2 G A 9: 51,277,600 A19V possibly damaging Het
Csmd1 A G 8: 15,895,731 C3561R probably damaging Het
Daxx T G 17: 33,911,281 V90G probably damaging Het
Dgkg T A 16: 22,622,304 probably benign Het
Dmrta2 A G 4: 109,982,025 H323R probably damaging Het
Dysf A T 6: 84,064,896 T161S probably benign Het
Fat1 G T 8: 45,031,274 R3183L probably benign Het
Fcho1 C A 8: 71,713,546 D347Y probably damaging Het
Gm21798 T C 15: 64,817,706 C5R unknown Het
Hmcn1 T C 1: 150,580,267 R5301G probably damaging Het
Hoxd11 T C 2: 74,684,115 F330L probably damaging Het
Lactbl1 A G 4: 136,637,639 D434G probably benign Het
Lgals8 A T 13: 12,448,481 N191K probably damaging Het
Lmod2 T A 6: 24,597,921 Y13* probably null Het
Malrd1 T C 2: 16,142,304 S1986P unknown Het
Map3k9 C T 12: 81,743,808 D324N probably damaging Het
Mcmbp C A 7: 128,703,582 K487N probably damaging Het
Mrpl4 G T 9: 21,002,771 probably benign Het
Nectin2 T C 7: 19,717,621 D496G possibly damaging Het
Nom1 T C 5: 29,442,536 S590P probably benign Het
Noto T C 6: 85,425,499 F156L probably damaging Het
Nrf1 T A 6: 30,116,272 D314E probably damaging Het
Nup93 T C 8: 94,303,632 L373P probably damaging Het
Olfr1002 T A 2: 85,648,168 Q51L not run Het
Olfr1168 A T 2: 88,184,966 M30L probably benign Het
Olfr1205 A G 2: 88,831,588 Q157R probably benign Het
Olfr1239 T C 2: 89,417,499 K305E possibly damaging Het
Olfr1369-ps1 A C 13: 21,116,021 I110L probably benign Het
Olfr1412 A C 1: 92,589,264 R311S probably benign Het
Pclo A T 5: 14,521,331 K243N probably damaging Het
Pdgfra T A 5: 75,170,603 C290S probably damaging Het
Pnlip G A 19: 58,679,634 probably null Het
Ptprm A T 17: 66,725,791 H1022Q probably benign Het
Rfx2 T C 17: 56,803,527 D153G probably benign Het
Rps6ka2 T C 17: 7,271,633 F317L probably damaging Het
Sarnp A G 10: 128,833,354 T27A probably benign Het
Shc3 A T 13: 51,448,006 M295K probably benign Het
Slc1a3 T A 15: 8,643,084 M304L probably damaging Het
Slco1a6 G T 6: 142,103,001 T351K possibly damaging Het
Snrk A G 9: 122,157,222 N219S probably damaging Het
Spats2 T A 15: 99,212,141 V473E probably benign Het
Stk35 T C 2: 129,810,725 L382P probably damaging Het
Tbx10 T C 19: 3,999,034 V315A probably benign Het
Tdpoz1 A G 3: 93,670,775 L234P probably damaging Het
Ttn T G 2: 76,714,145 E32832D probably benign Het
Ttn T C 2: 76,771,186 Y18678C probably damaging Het
Ugt2a2 A T 5: 87,474,494 M205K probably damaging Het
Utrn C A 10: 12,640,951 V2300L probably benign Het
Vmn1r175 T C 7: 23,808,422 N260S probably benign Het
Vmn1r63 T A 7: 5,803,001 I211L probably benign Het
Vmn1r83 A G 7: 12,321,615 W172R possibly damaging Het
Xirp2 T C 2: 67,510,634 L1073P probably benign Het
Zfp82 A G 7: 30,056,172 V495A possibly damaging Het
Other mutations in Rtl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Rtl1 APN 12 109593000 missense probably benign 0.00
IGL01981:Rtl1 APN 12 109591935 missense possibly damaging 0.72
IGL02418:Rtl1 APN 12 109590449 missense probably damaging 1.00
IGL03164:Rtl1 APN 12 109592933 missense probably damaging 1.00
FR4304:Rtl1 UTSW 12 109591198 small deletion probably benign
R0109:Rtl1 UTSW 12 109595407 start gained probably benign
R0141:Rtl1 UTSW 12 109592948 missense probably damaging 1.00
R0312:Rtl1 UTSW 12 109590227 missense probably damaging 0.99
R0389:Rtl1 UTSW 12 109590363 missense possibly damaging 0.77
R0390:Rtl1 UTSW 12 109591386 missense unknown
R0548:Rtl1 UTSW 12 109591655 missense probably damaging 0.98
R0561:Rtl1 UTSW 12 109593929 missense probably damaging 0.99
R0624:Rtl1 UTSW 12 109592719 missense probably damaging 0.97
R0746:Rtl1 UTSW 12 109592960 missense probably damaging 1.00
R1353:Rtl1 UTSW 12 109592199 missense probably benign 0.00
R1868:Rtl1 UTSW 12 109590536 missense probably damaging 1.00
R1935:Rtl1 UTSW 12 109591920 missense probably benign 0.42
R2000:Rtl1 UTSW 12 109593887 missense probably damaging 1.00
R2094:Rtl1 UTSW 12 109591397 missense unknown
R2125:Rtl1 UTSW 12 109593921 missense possibly damaging 0.64
R2166:Rtl1 UTSW 12 109590554 missense probably damaging 1.00
R2247:Rtl1 UTSW 12 109594979 missense possibly damaging 0.77
R2274:Rtl1 UTSW 12 109594667 missense unknown
R2919:Rtl1 UTSW 12 109591148 missense unknown
R2998:Rtl1 UTSW 12 109595096 missense probably damaging 0.99
R4554:Rtl1 UTSW 12 109594328 missense possibly damaging 0.53
R4566:Rtl1 UTSW 12 109592859 missense probably damaging 1.00
R4887:Rtl1 UTSW 12 109591704 missense probably damaging 0.96
R5399:Rtl1 UTSW 12 109590302 missense probably damaging 1.00
R5512:Rtl1 UTSW 12 109591371 missense unknown
R5616:Rtl1 UTSW 12 109592739 missense unknown
R5644:Rtl1 UTSW 12 109591579 missense probably benign 0.03
R5647:Rtl1 UTSW 12 109594679 missense unknown
R5695:Rtl1 UTSW 12 109594097 missense probably damaging 1.00
R5714:Rtl1 UTSW 12 109593680 missense probably damaging 0.99
R5786:Rtl1 UTSW 12 109592619 missense possibly damaging 0.89
R5917:Rtl1 UTSW 12 109591653 missense possibly damaging 0.82
R5948:Rtl1 UTSW 12 109590599 missense possibly damaging 0.86
R6051:Rtl1 UTSW 12 109593024 missense probably damaging 1.00
R6251:Rtl1 UTSW 12 109593649 missense probably benign 0.16
R6342:Rtl1 UTSW 12 109592301 missense possibly damaging 0.50
R6433:Rtl1 UTSW 12 109595196 missense unknown
R6815:Rtl1 UTSW 12 109594503 missense probably damaging 0.98
R6968:Rtl1 UTSW 12 109594679 missense unknown
R7002:Rtl1 UTSW 12 109593947 missense probably damaging 0.97
R7020:Rtl1 UTSW 12 109592315 missense possibly damaging 0.72
R7026:Rtl1 UTSW 12 109593161 missense probably damaging 0.99
R7027:Rtl1 UTSW 12 109591414 small deletion probably benign
R7196:Rtl1 UTSW 12 109592787 missense possibly damaging 0.83
R7239:Rtl1 UTSW 12 109592475 missense probably benign 0.05
R7312:Rtl1 UTSW 12 109595238 missense unknown
R7589:Rtl1 UTSW 12 109593845 missense possibly damaging 0.91
R7655:Rtl1 UTSW 12 109591008 missense unknown
R7656:Rtl1 UTSW 12 109591008 missense unknown
R7657:Rtl1 UTSW 12 109595384 missense possibly damaging 0.94
R7720:Rtl1 UTSW 12 109594430 missense possibly damaging 0.96
R7772:Rtl1 UTSW 12 109593185 missense probably damaging 1.00
R7840:Rtl1 UTSW 12 109594155 missense probably benign 0.08
R7890:Rtl1 UTSW 12 109592817 missense possibly damaging 0.57
R7893:Rtl1 UTSW 12 109593921 missense possibly damaging 0.64
R7894:Rtl1 UTSW 12 109594597 missense possibly damaging 0.70
R7909:Rtl1 UTSW 12 109590177 missense unknown
R7909:Rtl1 UTSW 12 109592480 missense possibly damaging 0.95
R7986:Rtl1 UTSW 12 109592058 missense possibly damaging 0.95
R8007:Rtl1 UTSW 12 109591626 missense possibly damaging 0.86
R8146:Rtl1 UTSW 12 109590711 missense probably benign 0.01
R8193:Rtl1 UTSW 12 109592216 missense probably benign 0.03
R8263:Rtl1 UTSW 12 109593746 missense probably damaging 0.99
R8273:Rtl1 UTSW 12 109592715 missense possibly damaging 0.92
R8512:Rtl1 UTSW 12 109594617 missense unknown
R8514:Rtl1 UTSW 12 109593873 missense possibly damaging 0.52
R8748:Rtl1 UTSW 12 109595058 missense probably benign 0.39
Z1088:Rtl1 UTSW 12 109592319 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CAACATCACCAGGACAGCTG -3'
(R):5'- CCCACTGCTGCTTATGTCCA -3'

Sequencing Primer
(F):5'- GCCACACCCAGGAGACTCTTC -3'
(R):5'- AGGTACTTTGACAGATCCTCTGAGAC -3'
Posted On2019-10-07