Incidental Mutation 'R7476:Olfr1369-ps1'
ID 579509
Institutional Source Beutler Lab
Gene Symbol Olfr1369-ps1
Ensembl Gene ENSMUSG00000060404
Gene Name olfactory receptor 1369, pseudogene 1
Synonyms GA_x6K02T2QHY8-12126170-12125935, MOR256-31
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.397) question?
Stock # R7476 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 21111483-21119095 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 21116021 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 110 (I110L)
Ref Sequence ENSEMBL: ENSMUSP00000150565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079050] [ENSMUST00000213326] [ENSMUST00000213922] [ENSMUST00000215207] [ENSMUST00000215941]
AlphaFold A0A140T8K7
Predicted Effect probably benign
Transcript: ENSMUST00000079050
AA Change: I110L

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000078059
Gene: ENSMUSG00000060404
AA Change: I110L

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.2e-47 PFAM
Pfam:7tm_1 41 290 1.1e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213326
AA Change: I110L

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000213922
AA Change: I110L

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000215207
AA Change: I110L

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000215941
AA Change: I110L

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik C T 6: 52,179,034 P27S unknown Het
Abi3bp A T 16: 56,614,746 K602* probably null Het
Adam29 G T 8: 55,873,195 H75N probably damaging Het
Ajap1 C T 4: 153,384,855 E373K probably damaging Het
Alg6 C A 4: 99,743,876 H206N probably damaging Het
Alox5 A T 6: 116,415,433 S376T probably benign Het
Arhgap19 A T 19: 41,782,363 Y321N probably benign Het
Brip1 A G 11: 86,157,808 V236A probably benign Het
C1ra C T 6: 124,522,699 P615S probably damaging Het
Ccdc69 C T 11: 55,051,198 V161I possibly damaging Het
Chil5 G A 3: 106,020,007 R163C possibly damaging Het
Cldnd1 A G 16: 58,729,544 D30G probably damaging Het
Colca2 G A 9: 51,277,600 A19V possibly damaging Het
Csmd1 A G 8: 15,895,731 C3561R probably damaging Het
Daxx T G 17: 33,911,281 V90G probably damaging Het
Dgkg T A 16: 22,622,304 probably benign Het
Dmrta2 A G 4: 109,982,025 H323R probably damaging Het
Dysf A T 6: 84,064,896 T161S probably benign Het
Fat1 G T 8: 45,031,274 R3183L probably benign Het
Fcho1 C A 8: 71,713,546 D347Y probably damaging Het
Gm21798 T C 15: 64,817,706 C5R unknown Het
Hmcn1 T C 1: 150,580,267 R5301G probably damaging Het
Hoxd11 T C 2: 74,684,115 F330L probably damaging Het
Lactbl1 A G 4: 136,637,639 D434G probably benign Het
Lgals8 A T 13: 12,448,481 N191K probably damaging Het
Lmod2 T A 6: 24,597,921 Y13* probably null Het
Malrd1 T C 2: 16,142,304 S1986P unknown Het
Map3k9 C T 12: 81,743,808 D324N probably damaging Het
Mcmbp C A 7: 128,703,582 K487N probably damaging Het
Mrpl4 G T 9: 21,002,771 probably benign Het
Nectin2 T C 7: 19,717,621 D496G possibly damaging Het
Nom1 T C 5: 29,442,536 S590P probably benign Het
Noto T C 6: 85,425,499 F156L probably damaging Het
Nrf1 T A 6: 30,116,272 D314E probably damaging Het
Nup93 T C 8: 94,303,632 L373P probably damaging Het
Olfr1002 T A 2: 85,648,168 Q51L not run Het
Olfr1168 A T 2: 88,184,966 M30L probably benign Het
Olfr1205 A G 2: 88,831,588 Q157R probably benign Het
Olfr1239 T C 2: 89,417,499 K305E possibly damaging Het
Olfr1412 A C 1: 92,589,264 R311S probably benign Het
Pclo A T 5: 14,521,331 K243N probably damaging Het
Pdgfra T A 5: 75,170,603 C290S probably damaging Het
Pnlip G A 19: 58,679,634 probably null Het
Ptprm A T 17: 66,725,791 H1022Q probably benign Het
Rfx2 T C 17: 56,803,527 D153G probably benign Het
Rps6ka2 T C 17: 7,271,633 F317L probably damaging Het
Rtl1 T A 12: 109,591,105 E1433D unknown Het
Sarnp A G 10: 128,833,354 T27A probably benign Het
Shc3 A T 13: 51,448,006 M295K probably benign Het
Slc1a3 T A 15: 8,643,084 M304L probably damaging Het
Slco1a6 G T 6: 142,103,001 T351K possibly damaging Het
Snrk A G 9: 122,157,222 N219S probably damaging Het
Spats2 T A 15: 99,212,141 V473E probably benign Het
Stk35 T C 2: 129,810,725 L382P probably damaging Het
Tbx10 T C 19: 3,999,034 V315A probably benign Het
Tdpoz1 A G 3: 93,670,775 L234P probably damaging Het
Ttn T G 2: 76,714,145 E32832D probably benign Het
Ttn T C 2: 76,771,186 Y18678C probably damaging Het
Ugt2a2 A T 5: 87,474,494 M205K probably damaging Het
Utrn C A 10: 12,640,951 V2300L probably benign Het
Vmn1r175 T C 7: 23,808,422 N260S probably benign Het
Vmn1r63 T A 7: 5,803,001 I211L probably benign Het
Vmn1r83 A G 7: 12,321,615 W172R possibly damaging Het
Xirp2 T C 2: 67,510,634 L1073P probably benign Het
Zfp82 A G 7: 30,056,172 V495A possibly damaging Het
Other mutations in Olfr1369-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01689:Olfr1369-ps1 APN 13 21116073 missense probably damaging 0.97
R0631:Olfr1369-ps1 UTSW 13 21115908 missense probably damaging 1.00
R0960:Olfr1369-ps1 UTSW 13 21116265 missense possibly damaging 0.94
R1499:Olfr1369-ps1 UTSW 13 21116133 missense probably benign 0.32
R1549:Olfr1369-ps1 UTSW 13 21116118 missense probably benign 0.01
R1698:Olfr1369-ps1 UTSW 13 21116565 missense probably benign 0.11
R1711:Olfr1369-ps1 UTSW 13 21116306 missense probably benign 0.01
R2404:Olfr1369-ps1 UTSW 13 21115842 missense probably damaging 1.00
R2471:Olfr1369-ps1 UTSW 13 21116429 missense probably damaging 1.00
R3844:Olfr1369-ps1 UTSW 13 21116063 missense possibly damaging 0.91
R3977:Olfr1369-ps1 UTSW 13 21115861 missense probably benign 0.03
R3979:Olfr1369-ps1 UTSW 13 21115861 missense probably benign 0.03
R4804:Olfr1369-ps1 UTSW 13 21116005 nonsense probably null
R4914:Olfr1369-ps1 UTSW 13 21116397 missense probably benign 0.12
R5210:Olfr1369-ps1 UTSW 13 21116052 missense probably damaging 0.99
R5359:Olfr1369-ps1 UTSW 13 21116267 missense probably damaging 1.00
R5700:Olfr1369-ps1 UTSW 13 21116001 missense probably damaging 1.00
R6218:Olfr1369-ps1 UTSW 13 21116231 missense probably damaging 1.00
R6767:Olfr1369-ps1 UTSW 13 21116057 missense probably benign 0.02
R7396:Olfr1369-ps1 UTSW 13 21116307 missense probably benign 0.02
R7612:Olfr1369-ps1 UTSW 13 21116047 missense probably damaging 0.99
R8257:Olfr1369-ps1 UTSW 13 21116373 missense probably benign 0.11
R9388:Olfr1369-ps1 UTSW 13 21116604 missense probably damaging 0.96
V8831:Olfr1369-ps1 UTSW 13 21116003 missense possibly damaging 0.93
Z1176:Olfr1369-ps1 UTSW 13 21116601 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACACTGCTATAATTCTTGCATCCC -3'
(R):5'- CTGGCAACTCACACAGGAAG -3'

Sequencing Primer
(F):5'- GCTATAATTCTTGCATCCCTCCTGG -3'
(R):5'- ATGTTATGTCCACATCGAGGC -3'
Posted On 2019-10-07