Incidental Mutation 'R7476:Or2w1b'
ID 579509
Institutional Source Beutler Lab
Gene Symbol Or2w1b
Ensembl Gene ENSMUSG00000060404
Gene Name olfactory receptor family 2 subfamily W member 1B
Synonyms Olfr1369, MOR256-31, GA_x6K02T2QHY8-12126170-12125935
MMRRC Submission 045550-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.346) question?
Stock # R7476 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 21299764-21300871 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 21300191 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 110 (I110L)
Ref Sequence ENSEMBL: ENSMUSP00000150565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079050] [ENSMUST00000213326] [ENSMUST00000213922] [ENSMUST00000215207] [ENSMUST00000215941]
AlphaFold A0A140T8K7
Predicted Effect probably benign
Transcript: ENSMUST00000079050
AA Change: I110L

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000078059
Gene: ENSMUSG00000060404
AA Change: I110L

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.2e-47 PFAM
Pfam:7tm_1 41 290 1.1e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213326
AA Change: I110L

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000213922
AA Change: I110L

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000215207
AA Change: I110L

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000215941
AA Change: I110L

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik C T 6: 52,156,014 (GRCm39) P27S unknown Het
Abi3bp A T 16: 56,435,109 (GRCm39) K602* probably null Het
Adam29 G T 8: 56,326,230 (GRCm39) H75N probably damaging Het
Ajap1 C T 4: 153,469,312 (GRCm39) E373K probably damaging Het
Alg6 C A 4: 99,632,113 (GRCm39) H206N probably damaging Het
Alox5 A T 6: 116,392,394 (GRCm39) S376T probably benign Het
Arhgap19 A T 19: 41,770,802 (GRCm39) Y321N probably benign Het
Brip1 A G 11: 86,048,634 (GRCm39) V236A probably benign Het
C1ra C T 6: 124,499,658 (GRCm39) P615S probably damaging Het
Ccdc69 C T 11: 54,942,024 (GRCm39) V161I possibly damaging Het
Chil5 G A 3: 105,927,323 (GRCm39) R163C possibly damaging Het
Cldnd1 A G 16: 58,549,907 (GRCm39) D30G probably damaging Het
Csmd1 A G 8: 15,945,731 (GRCm39) C3561R probably damaging Het
Daxx T G 17: 34,130,255 (GRCm39) V90G probably damaging Het
Dgkg T A 16: 22,441,054 (GRCm39) probably benign Het
Dmrta2 A G 4: 109,839,222 (GRCm39) H323R probably damaging Het
Dysf A T 6: 84,041,878 (GRCm39) T161S probably benign Het
Fat1 G T 8: 45,484,311 (GRCm39) R3183L probably benign Het
Fcho1 C A 8: 72,166,190 (GRCm39) D347Y probably damaging Het
Gm21798 T C 15: 64,689,555 (GRCm39) C5R unknown Het
Hmcn1 T C 1: 150,456,018 (GRCm39) R5301G probably damaging Het
Hoxd11 T C 2: 74,514,459 (GRCm39) F330L probably damaging Het
Lactbl1 A G 4: 136,364,950 (GRCm39) D434G probably benign Het
Lgals8 A T 13: 12,463,362 (GRCm39) N191K probably damaging Het
Lmod2 T A 6: 24,597,920 (GRCm39) Y13* probably null Het
Malrd1 T C 2: 16,147,115 (GRCm39) S1986P unknown Het
Map3k9 C T 12: 81,790,582 (GRCm39) D324N probably damaging Het
Mcmbp C A 7: 128,305,306 (GRCm39) K487N probably damaging Het
Mrpl4 G T 9: 20,914,067 (GRCm39) probably benign Het
Nectin2 T C 7: 19,451,546 (GRCm39) D496G possibly damaging Het
Nom1 T C 5: 29,647,534 (GRCm39) S590P probably benign Het
Noto T C 6: 85,402,481 (GRCm39) F156L probably damaging Het
Nrf1 T A 6: 30,116,271 (GRCm39) D314E probably damaging Het
Nup93 T C 8: 95,030,260 (GRCm39) L373P probably damaging Het
Or4a2 T C 2: 89,247,843 (GRCm39) K305E possibly damaging Het
Or4c11c A G 2: 88,661,932 (GRCm39) Q157R probably benign Het
Or5d40 A T 2: 88,015,310 (GRCm39) M30L probably benign Het
Or5g25 T A 2: 85,478,512 (GRCm39) Q51L not run Het
Or9s27 A C 1: 92,516,986 (GRCm39) R311S probably benign Het
Pclo A T 5: 14,571,345 (GRCm39) K243N probably damaging Het
Pdgfra T A 5: 75,331,264 (GRCm39) C290S probably damaging Het
Pnlip G A 19: 58,668,066 (GRCm39) probably null Het
Pou2af3 G A 9: 51,188,900 (GRCm39) A19V possibly damaging Het
Ptprm A T 17: 67,032,786 (GRCm39) H1022Q probably benign Het
Rfx2 T C 17: 57,110,527 (GRCm39) D153G probably benign Het
Rps6ka2 T C 17: 7,539,032 (GRCm39) F317L probably damaging Het
Rtl1 T A 12: 109,557,539 (GRCm39) E1433D unknown Het
Sarnp A G 10: 128,669,223 (GRCm39) T27A probably benign Het
Shc3 A T 13: 51,602,042 (GRCm39) M295K probably benign Het
Slc1a3 T A 15: 8,672,568 (GRCm39) M304L probably damaging Het
Slco1a6 G T 6: 142,048,727 (GRCm39) T351K possibly damaging Het
Snrk A G 9: 121,986,288 (GRCm39) N219S probably damaging Het
Spats2 T A 15: 99,110,022 (GRCm39) V473E probably benign Het
Stk35 T C 2: 129,652,645 (GRCm39) L382P probably damaging Het
Tbx10 T C 19: 4,049,034 (GRCm39) V315A probably benign Het
Tdpoz1 A G 3: 93,578,082 (GRCm39) L234P probably damaging Het
Ttn T G 2: 76,544,489 (GRCm39) E32832D probably benign Het
Ttn T C 2: 76,601,530 (GRCm39) Y18678C probably damaging Het
Ugt2a2 A T 5: 87,622,353 (GRCm39) M205K probably damaging Het
Utrn C A 10: 12,516,695 (GRCm39) V2300L probably benign Het
Vmn1r175 T C 7: 23,507,847 (GRCm39) N260S probably benign Het
Vmn1r63 T A 7: 5,806,000 (GRCm39) I211L probably benign Het
Vmn1r83 A G 7: 12,055,542 (GRCm39) W172R possibly damaging Het
Xirp2 T C 2: 67,340,978 (GRCm39) L1073P probably benign Het
Zfp82 A G 7: 29,755,597 (GRCm39) V495A possibly damaging Het
Other mutations in Or2w1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01689:Or2w1b APN 13 21,300,243 (GRCm39) missense probably damaging 0.97
R0631:Or2w1b UTSW 13 21,300,078 (GRCm39) missense probably damaging 1.00
R0960:Or2w1b UTSW 13 21,300,435 (GRCm39) missense possibly damaging 0.94
R1499:Or2w1b UTSW 13 21,300,303 (GRCm39) missense probably benign 0.32
R1549:Or2w1b UTSW 13 21,300,288 (GRCm39) missense probably benign 0.01
R1698:Or2w1b UTSW 13 21,300,735 (GRCm39) missense probably benign 0.11
R1711:Or2w1b UTSW 13 21,300,476 (GRCm39) missense probably benign 0.01
R2404:Or2w1b UTSW 13 21,300,012 (GRCm39) missense probably damaging 1.00
R2471:Or2w1b UTSW 13 21,300,599 (GRCm39) missense probably damaging 1.00
R3844:Or2w1b UTSW 13 21,300,233 (GRCm39) missense possibly damaging 0.91
R3977:Or2w1b UTSW 13 21,300,031 (GRCm39) missense probably benign 0.03
R3979:Or2w1b UTSW 13 21,300,031 (GRCm39) missense probably benign 0.03
R4804:Or2w1b UTSW 13 21,300,175 (GRCm39) nonsense probably null
R4914:Or2w1b UTSW 13 21,300,567 (GRCm39) missense probably benign 0.12
R5210:Or2w1b UTSW 13 21,300,222 (GRCm39) missense probably damaging 0.99
R5359:Or2w1b UTSW 13 21,300,437 (GRCm39) missense probably damaging 1.00
R5700:Or2w1b UTSW 13 21,300,171 (GRCm39) missense probably damaging 1.00
R6218:Or2w1b UTSW 13 21,300,401 (GRCm39) missense probably damaging 1.00
R6767:Or2w1b UTSW 13 21,300,227 (GRCm39) missense probably benign 0.02
R7396:Or2w1b UTSW 13 21,300,477 (GRCm39) missense probably benign 0.02
R7612:Or2w1b UTSW 13 21,300,217 (GRCm39) missense probably damaging 0.99
R8257:Or2w1b UTSW 13 21,300,543 (GRCm39) missense probably benign 0.11
R9388:Or2w1b UTSW 13 21,300,774 (GRCm39) missense probably damaging 0.96
R9697:Or2w1b UTSW 13 21,299,892 (GRCm39) missense probably benign 0.21
V8831:Or2w1b UTSW 13 21,300,173 (GRCm39) missense possibly damaging 0.93
Z1176:Or2w1b UTSW 13 21,300,771 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACACTGCTATAATTCTTGCATCCC -3'
(R):5'- CTGGCAACTCACACAGGAAG -3'

Sequencing Primer
(F):5'- GCTATAATTCTTGCATCCCTCCTGG -3'
(R):5'- ATGTTATGTCCACATCGAGGC -3'
Posted On 2019-10-07