Incidental Mutation 'R7476:Cldnd1'
ID579516
Institutional Source Beutler Lab
Gene Symbol Cldnd1
Ensembl Gene ENSMUSG00000022744
Gene Nameclaudin domain containing 1
Synonyms1110019C08Rik, Cldn25
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R7476 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location58727910-58734251 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58729544 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 30 (D30G)
Ref Sequence ENSEMBL: ENSMUSP00000023426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023426] [ENSMUST00000159944] [ENSMUST00000162057] [ENSMUST00000162191]
Predicted Effect probably damaging
Transcript: ENSMUST00000023426
AA Change: D30G

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000023426
Gene: ENSMUSG00000022744
AA Change: D30G

DomainStartEndE-ValueType
Pfam:Claudin_2 17 235 9.2e-25 PFAM
Pfam:PMP22_Claudin 101 233 7.2e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159944
AA Change: D30G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124455
Gene: ENSMUSG00000022744
AA Change: D30G

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162057
AA Change: D30G

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125497
Gene: ENSMUSG00000022744
AA Change: D30G

DomainStartEndE-ValueType
Pfam:Claudin_2 17 235 1.2e-24 PFAM
Pfam:PMP22_Claudin 101 233 7.4e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162191
AA Change: D30G

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124461
Gene: ENSMUSG00000022744
AA Change: D30G

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik C T 6: 52,179,034 P27S unknown Het
Abi3bp A T 16: 56,614,746 K602* probably null Het
Adam29 G T 8: 55,873,195 H75N probably damaging Het
Ajap1 C T 4: 153,384,855 E373K probably damaging Het
Alg6 C A 4: 99,743,876 H206N probably damaging Het
Alox5 A T 6: 116,415,433 S376T probably benign Het
Arhgap19 A T 19: 41,782,363 Y321N probably benign Het
Brip1 A G 11: 86,157,808 V236A probably benign Het
C1ra C T 6: 124,522,699 P615S probably damaging Het
Ccdc69 C T 11: 55,051,198 V161I possibly damaging Het
Chil5 G A 3: 106,020,007 R163C possibly damaging Het
Colca2 G A 9: 51,277,600 A19V possibly damaging Het
Csmd1 A G 8: 15,895,731 C3561R probably damaging Het
Daxx T G 17: 33,911,281 V90G probably damaging Het
Dgkg T A 16: 22,622,304 probably benign Het
Dmrta2 A G 4: 109,982,025 H323R probably damaging Het
Dysf A T 6: 84,064,896 T161S probably benign Het
Fat1 G T 8: 45,031,274 R3183L probably benign Het
Fcho1 C A 8: 71,713,546 D347Y probably damaging Het
Gm21798 T C 15: 64,817,706 C5R unknown Het
Hmcn1 T C 1: 150,580,267 R5301G probably damaging Het
Hoxd11 T C 2: 74,684,115 F330L probably damaging Het
Lactbl1 A G 4: 136,637,639 D434G probably benign Het
Lgals8 A T 13: 12,448,481 N191K probably damaging Het
Lmod2 T A 6: 24,597,921 Y13* probably null Het
Malrd1 T C 2: 16,142,304 S1986P unknown Het
Map3k9 C T 12: 81,743,808 D324N probably damaging Het
Mcmbp C A 7: 128,703,582 K487N probably damaging Het
Mrpl4 G T 9: 21,002,771 probably benign Het
Nectin2 T C 7: 19,717,621 D496G possibly damaging Het
Nom1 T C 5: 29,442,536 S590P probably benign Het
Noto T C 6: 85,425,499 F156L probably damaging Het
Nrf1 T A 6: 30,116,272 D314E probably damaging Het
Nup93 T C 8: 94,303,632 L373P probably damaging Het
Olfr1002 T A 2: 85,648,168 Q51L not run Het
Olfr1168 A T 2: 88,184,966 M30L probably benign Het
Olfr1205 A G 2: 88,831,588 Q157R probably benign Het
Olfr1239 T C 2: 89,417,499 K305E possibly damaging Het
Olfr1369-ps1 A C 13: 21,116,021 I110L probably benign Het
Olfr1412 A C 1: 92,589,264 R311S probably benign Het
Pclo A T 5: 14,521,331 K243N probably damaging Het
Pdgfra T A 5: 75,170,603 C290S probably damaging Het
Pnlip G A 19: 58,679,634 probably null Het
Ptprm A T 17: 66,725,791 H1022Q probably benign Het
Rfx2 T C 17: 56,803,527 D153G probably benign Het
Rps6ka2 T C 17: 7,271,633 F317L probably damaging Het
Rtl1 T A 12: 109,591,105 E1433D unknown Het
Sarnp A G 10: 128,833,354 T27A probably benign Het
Shc3 A T 13: 51,448,006 M295K probably benign Het
Slc1a3 T A 15: 8,643,084 M304L probably damaging Het
Slco1a6 G T 6: 142,103,001 T351K possibly damaging Het
Snrk A G 9: 122,157,222 N219S probably damaging Het
Spats2 T A 15: 99,212,141 V473E probably benign Het
Stk35 T C 2: 129,810,725 L382P probably damaging Het
Tbx10 T C 19: 3,999,034 V315A probably benign Het
Tdpoz1 A G 3: 93,670,775 L234P probably damaging Het
Ttn T G 2: 76,714,145 E32832D probably benign Het
Ttn T C 2: 76,771,186 Y18678C probably damaging Het
Ugt2a2 A T 5: 87,474,494 M205K probably damaging Het
Utrn C A 10: 12,640,951 V2300L probably benign Het
Vmn1r175 T C 7: 23,808,422 N260S probably benign Het
Vmn1r63 T A 7: 5,803,001 I211L probably benign Het
Vmn1r83 A G 7: 12,321,615 W172R possibly damaging Het
Xirp2 T C 2: 67,510,634 L1073P probably benign Het
Zfp82 A G 7: 30,056,172 V495A possibly damaging Het
Other mutations in Cldnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03110:Cldnd1 APN 16 58729596 missense possibly damaging 0.67
R0010:Cldnd1 UTSW 16 58731259 intron probably benign
R0010:Cldnd1 UTSW 16 58731259 intron probably benign
R0097:Cldnd1 UTSW 16 58729715 missense possibly damaging 0.80
R0131:Cldnd1 UTSW 16 58732992 missense probably damaging 1.00
R1577:Cldnd1 UTSW 16 58732653 missense possibly damaging 0.79
R4745:Cldnd1 UTSW 16 58729643 missense probably benign 0.21
R5323:Cldnd1 UTSW 16 58729653 missense possibly damaging 0.77
R6226:Cldnd1 UTSW 16 58731300 critical splice acceptor site probably null
R6987:Cldnd1 UTSW 16 58731371 missense probably benign 0.09
R7337:Cldnd1 UTSW 16 58728959 splice site probably null
R7942:Cldnd1 UTSW 16 58729715 missense possibly damaging 0.79
Z1177:Cldnd1 UTSW 16 58729681 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATTGCGTTATGGAAAGAAG -3'
(R):5'- CAGACAAGCTTGCACGTCAC -3'

Sequencing Primer
(F):5'- CATTGCGTTATGGAAAGAAGGGATG -3'
(R):5'- CACTGGGCCATCATTATTAGGACG -3'
Posted On2019-10-07