Incidental Mutation 'R7476:Rfx2'
ID579519
Institutional Source Beutler Lab
Gene Symbol Rfx2
Ensembl Gene ENSMUSG00000024206
Gene Nameregulatory factor X, 2 (influences HLA class II expression)
Synonyms5430432H19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.728) question?
Stock #R7476 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location56775897-56831008 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56803527 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 153 (D153G)
Ref Sequence ENSEMBL: ENSMUSP00000002444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002444] [ENSMUST00000086801]
Predicted Effect probably benign
Transcript: ENSMUST00000002444
AA Change: D153G

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000002444
Gene: ENSMUSG00000024206
AA Change: D153G

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 4 149 1.9e-50 PFAM
Pfam:RFX_DNA_binding 192 269 4.3e-36 PFAM
Blast:HisKA 479 542 1e-31 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000086801
AA Change: D153G

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000084010
Gene: ENSMUSG00000024206
AA Change: D153G

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 1 151 6.8e-56 PFAM
Pfam:RFX_DNA_binding 161 246 6e-41 PFAM
Blast:HisKA 454 517 1e-31 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the regulatory factor X gene family, which encodes transcription factors that contain a highly-conserved winged helix DNA binding domain. The protein encoded by this gene is structurally related to regulatory factors X1, X3, X4, and X5. It is a transcriptional activator that can bind DNA as a monomer or as a heterodimer with other RFX family members. This protein can bind to cis elements in the promoter of the IL-5 receptor alpha gene. Two transcript variants encoding different isoforms have been described for this gene, and both variants utilize alternative polyadenylation sites. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and lack an obvious embryonic phenotype but exhibit male infertility associated with a defect in spermatid maturation at or before the round and elongating spermatid stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik C T 6: 52,179,034 P27S unknown Het
Abi3bp A T 16: 56,614,746 K602* probably null Het
Adam29 G T 8: 55,873,195 H75N probably damaging Het
Ajap1 C T 4: 153,384,855 E373K probably damaging Het
Alg6 C A 4: 99,743,876 H206N probably damaging Het
Alox5 A T 6: 116,415,433 S376T probably benign Het
Arhgap19 A T 19: 41,782,363 Y321N probably benign Het
Brip1 A G 11: 86,157,808 V236A probably benign Het
C1ra C T 6: 124,522,699 P615S probably damaging Het
Ccdc69 C T 11: 55,051,198 V161I possibly damaging Het
Chil5 G A 3: 106,020,007 R163C possibly damaging Het
Cldnd1 A G 16: 58,729,544 D30G probably damaging Het
Colca2 G A 9: 51,277,600 A19V possibly damaging Het
Csmd1 A G 8: 15,895,731 C3561R probably damaging Het
Daxx T G 17: 33,911,281 V90G probably damaging Het
Dgkg T A 16: 22,622,304 probably benign Het
Dmrta2 A G 4: 109,982,025 H323R probably damaging Het
Dysf A T 6: 84,064,896 T161S probably benign Het
Fat1 G T 8: 45,031,274 R3183L probably benign Het
Fcho1 C A 8: 71,713,546 D347Y probably damaging Het
Gm21798 T C 15: 64,817,706 C5R unknown Het
Hmcn1 T C 1: 150,580,267 R5301G probably damaging Het
Hoxd11 T C 2: 74,684,115 F330L probably damaging Het
Lactbl1 A G 4: 136,637,639 D434G probably benign Het
Lgals8 A T 13: 12,448,481 N191K probably damaging Het
Lmod2 T A 6: 24,597,921 Y13* probably null Het
Malrd1 T C 2: 16,142,304 S1986P unknown Het
Map3k9 C T 12: 81,743,808 D324N probably damaging Het
Mcmbp C A 7: 128,703,582 K487N probably damaging Het
Mrpl4 G T 9: 21,002,771 probably benign Het
Nectin2 T C 7: 19,717,621 D496G possibly damaging Het
Nom1 T C 5: 29,442,536 S590P probably benign Het
Noto T C 6: 85,425,499 F156L probably damaging Het
Nrf1 T A 6: 30,116,272 D314E probably damaging Het
Nup93 T C 8: 94,303,632 L373P probably damaging Het
Olfr1002 T A 2: 85,648,168 Q51L not run Het
Olfr1168 A T 2: 88,184,966 M30L probably benign Het
Olfr1205 A G 2: 88,831,588 Q157R probably benign Het
Olfr1239 T C 2: 89,417,499 K305E possibly damaging Het
Olfr1369-ps1 A C 13: 21,116,021 I110L probably benign Het
Olfr1412 A C 1: 92,589,264 R311S probably benign Het
Pclo A T 5: 14,521,331 K243N probably damaging Het
Pdgfra T A 5: 75,170,603 C290S probably damaging Het
Pnlip G A 19: 58,679,634 probably null Het
Ptprm A T 17: 66,725,791 H1022Q probably benign Het
Rps6ka2 T C 17: 7,271,633 F317L probably damaging Het
Rtl1 T A 12: 109,591,105 E1433D unknown Het
Sarnp A G 10: 128,833,354 T27A probably benign Het
Shc3 A T 13: 51,448,006 M295K probably benign Het
Slc1a3 T A 15: 8,643,084 M304L probably damaging Het
Slco1a6 G T 6: 142,103,001 T351K possibly damaging Het
Snrk A G 9: 122,157,222 N219S probably damaging Het
Spats2 T A 15: 99,212,141 V473E probably benign Het
Stk35 T C 2: 129,810,725 L382P probably damaging Het
Tbx10 T C 19: 3,999,034 V315A probably benign Het
Tdpoz1 A G 3: 93,670,775 L234P probably damaging Het
Ttn T G 2: 76,714,145 E32832D probably benign Het
Ttn T C 2: 76,771,186 Y18678C probably damaging Het
Ugt2a2 A T 5: 87,474,494 M205K probably damaging Het
Utrn C A 10: 12,640,951 V2300L probably benign Het
Vmn1r175 T C 7: 23,808,422 N260S probably benign Het
Vmn1r63 T A 7: 5,803,001 I211L probably benign Het
Vmn1r83 A G 7: 12,321,615 W172R possibly damaging Het
Xirp2 T C 2: 67,510,634 L1073P probably benign Het
Zfp82 A G 7: 30,056,172 V495A possibly damaging Het
Other mutations in Rfx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Rfx2 APN 17 56783657 missense probably damaging 1.00
IGL01296:Rfx2 APN 17 56808317 start codon destroyed possibly damaging 0.81
IGL01488:Rfx2 APN 17 56805398 missense probably damaging 1.00
IGL01705:Rfx2 APN 17 56785303 missense possibly damaging 0.88
IGL02389:Rfx2 APN 17 56808325 splice site probably benign
IGL02601:Rfx2 APN 17 56785354 missense possibly damaging 0.75
IGL02609:Rfx2 APN 17 56805404 missense probably benign 0.00
R0066:Rfx2 UTSW 17 56786736 splice site probably benign
R0066:Rfx2 UTSW 17 56786736 splice site probably benign
R0197:Rfx2 UTSW 17 56803722 missense probably damaging 0.99
R0370:Rfx2 UTSW 17 56799308 missense probably benign 0.03
R0413:Rfx2 UTSW 17 56784418 splice site probably benign
R0622:Rfx2 UTSW 17 56777071 missense probably damaging 0.99
R0883:Rfx2 UTSW 17 56803722 missense probably damaging 0.99
R1429:Rfx2 UTSW 17 56804369 missense probably damaging 0.97
R1439:Rfx2 UTSW 17 56787720 missense probably damaging 1.00
R1569:Rfx2 UTSW 17 56804326 missense possibly damaging 0.63
R1654:Rfx2 UTSW 17 56808263 missense probably benign 0.00
R1751:Rfx2 UTSW 17 56784754 missense probably benign 0.01
R1816:Rfx2 UTSW 17 56808305 nonsense probably null
R2282:Rfx2 UTSW 17 56803722 missense probably damaging 0.99
R3408:Rfx2 UTSW 17 56803526 missense probably benign 0.00
R3962:Rfx2 UTSW 17 56785302 missense probably damaging 0.99
R4415:Rfx2 UTSW 17 56787733 missense possibly damaging 0.95
R4876:Rfx2 UTSW 17 56784706 missense probably benign 0.00
R4883:Rfx2 UTSW 17 56783747 missense probably damaging 0.98
R5588:Rfx2 UTSW 17 56779890 missense possibly damaging 0.69
R5766:Rfx2 UTSW 17 56803587 missense probably benign 0.02
R5798:Rfx2 UTSW 17 56804362 missense possibly damaging 0.89
R5931:Rfx2 UTSW 17 56780778 missense probably damaging 0.99
R6061:Rfx2 UTSW 17 56777473 missense possibly damaging 0.86
R6466:Rfx2 UTSW 17 56784397 missense probably benign 0.13
R6800:Rfx2 UTSW 17 56780804 missense probably damaging 0.99
R7329:Rfx2 UTSW 17 56803681 missense probably benign 0.05
R8159:Rfx2 UTSW 17 56803605 missense probably benign 0.43
R8274:Rfx2 UTSW 17 56804348 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAGGGCCCAATCCTAAAGG -3'
(R):5'- GGTGATGCTTTCTCTCCCACAG -3'

Sequencing Primer
(F):5'- GGCCCAATCCTAAAGGCCTTTG -3'
(R):5'- AGACCCTCAGCTTTACGCC -3'
Posted On2019-10-07