Incidental Mutation 'R7477:Fam171a1'
ID 579525
Institutional Source Beutler Lab
Gene Symbol Fam171a1
Ensembl Gene ENSMUSG00000050530
Gene Name family with sequence similarity 171, member A1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock # R7477 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 3114224-3227806 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 3225639 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 603 (V603A)
Ref Sequence ENSEMBL: ENSMUSP00000110751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062934] [ENSMUST00000072955] [ENSMUST00000091505] [ENSMUST00000115099]
AlphaFold A2ATK9
Predicted Effect probably benign
Transcript: ENSMUST00000062934
AA Change: V598A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000053619
Gene: ENSMUSG00000050530
AA Change: V598A

DomainStartEndE-ValueType
Pfam:UPF0560 29 885 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072955
AA Change: V478A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000072724
Gene: ENSMUSG00000050530
AA Change: V478A

DomainStartEndE-ValueType
Pfam:UPF0560 1 765 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091505
SMART Domains Protein: ENSMUSP00000089086
Gene: ENSMUSG00000050530

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:UPF0560 34 294 3.1e-146 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115099
AA Change: V603A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000110751
Gene: ENSMUSG00000050530
AA Change: V603A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:UPF0560 34 890 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 G T 5: 35,592,103 E191* probably null Het
Adam26a T A 8: 43,569,070 E461V probably damaging Het
Adamtsl1 G A 4: 86,415,651 R1539Q probably damaging Het
Adipor2 A T 6: 119,361,922 H123Q probably benign Het
Akap13 C T 7: 75,749,247 S2691L probably benign Het
Aldh1l1 T C 6: 90,598,387 probably null Het
Ankrd11 A T 8: 122,894,385 S909R possibly damaging Het
BC049730 A G 7: 24,714,248 T230A probably benign Het
Bop1 T C 15: 76,455,326 E273G probably damaging Het
Car1 G A 3: 14,776,283 H97Y probably damaging Het
Casp14 T C 10: 78,714,304 N170S probably benign Het
Ccdc158 A T 5: 92,650,696 L382M probably damaging Het
Ccdc18 A C 5: 108,220,850 Q1279H probably damaging Het
Cdh18 A G 15: 23,410,725 N432S probably benign Het
Ctdp1 T C 18: 80,440,714 probably null Het
Dhx30 A G 9: 110,087,140 I691T probably damaging Het
Dnah9 A G 11: 65,992,731 I2562T probably damaging Het
Dsp A T 13: 38,172,863 I240F probably damaging Het
Ell T C 8: 70,585,218 S308P probably benign Het
Elmo1 A G 13: 20,285,319 D26G Het
Fam83e G A 7: 45,728,980 G476D probably damaging Het
Farp2 A G 1: 93,581,028 probably null Het
Fcer1a C T 1: 173,221,284 probably null Het
Gpr179 G T 11: 97,335,839 T1830K possibly damaging Het
Grin3a G A 4: 49,719,278 P823S probably damaging Het
Heatr4 T A 12: 83,979,830 I218F probably damaging Het
Il1f5 T A 2: 24,279,692 Y21* probably null Het
Jakmip1 A G 5: 37,173,571 T532A probably benign Het
Klf11 A G 12: 24,653,563 D16G probably benign Het
Lrp1 T A 10: 127,568,920 I1971F probably damaging Het
Lrrc9 T A 12: 72,503,527 probably null Het
Lrrk2 C T 15: 91,812,325 L2439F probably damaging Het
Mapk14 G A 17: 28,745,078 D313N probably damaging Het
Max A T 12: 76,953,186 S52T probably benign Het
Mrpl23 A G 7: 142,537,281 R80G possibly damaging Het
Muc5ac C A 7: 141,816,282 N3186K possibly damaging Het
Mylk2 G A 2: 152,920,341 V511I probably damaging Het
Mypn T C 10: 63,125,721 M1031V possibly damaging Het
Nbeal1 A G 1: 60,261,584 T1488A probably benign Het
Ncbp1 A T 4: 46,157,897 E378D probably damaging Het
Nedd9 A T 13: 41,318,480 D174E probably benign Het
Nid2 T A 14: 19,805,973 D1255E probably benign Het
Nlrc3 A G 16: 3,964,811 C261R probably damaging Het
Olfr153 A G 2: 87,532,087 N18S probably benign Het
Pgam1 T A 19: 41,916,816 H196Q probably damaging Het
Pja2 A C 17: 64,309,645 V85G possibly damaging Het
Pkd2 G A 5: 104,483,242 V511M probably benign Het
Ppp2cb T A 8: 33,615,474 S171T probably benign Het
Prkab2 T C 3: 97,658,747 F45S probably damaging Het
Rabep2 A T 7: 126,444,818 probably null Het
Rnf41 T A 10: 128,435,434 I71N probably damaging Het
Slc5a7 G A 17: 54,281,759 P287S probably damaging Het
Smc6 A G 12: 11,271,807 D25G probably benign Het
Sptb A T 12: 76,628,565 L225Q probably damaging Het
Tenm4 A C 7: 96,845,808 I1148L probably damaging Het
Tnk2 C A 16: 32,677,891 probably null Het
Trank1 G A 9: 111,364,957 S683N probably benign Het
Trp53bp1 A C 2: 121,236,346 V633G probably benign Het
Ugt2a3 T C 5: 87,336,620 K182E possibly damaging Het
Uncx A T 5: 139,547,262 T361S probably benign Het
Vmn2r11 A T 5: 109,059,348 N35K possibly damaging Het
Vmn2r4 C A 3: 64,398,429 R524L probably benign Het
Vmn2r5 C T 3: 64,491,639 V640M probably damaging Het
Washc4 T C 10: 83,574,443 Y632H probably damaging Het
Xkr6 T C 14: 63,606,680 S51P possibly damaging Het
Zer1 C A 2: 30,107,976 K408N probably null Het
Znhit2 A G 19: 6,062,471 probably null Het
Other mutations in Fam171a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Fam171a1 APN 2 3178290 missense possibly damaging 0.90
IGL01138:Fam171a1 APN 2 3202620 missense possibly damaging 0.80
IGL01317:Fam171a1 APN 2 3202626 missense probably damaging 1.00
IGL02377:Fam171a1 APN 2 3223586 critical splice donor site probably null
IGL02475:Fam171a1 APN 2 3223490 missense possibly damaging 0.53
IGL02477:Fam171a1 APN 2 3202575 missense possibly damaging 0.83
ghosted UTSW 2 3225152 nonsense probably null
R0167:Fam171a1 UTSW 2 3186432 missense probably damaging 1.00
R0426:Fam171a1 UTSW 2 3225396 missense probably benign
R0468:Fam171a1 UTSW 2 3225396 missense probably benign
R0811:Fam171a1 UTSW 2 3197427 missense probably damaging 1.00
R0812:Fam171a1 UTSW 2 3197427 missense probably damaging 1.00
R1099:Fam171a1 UTSW 2 3225317 missense probably benign 0.24
R1694:Fam171a1 UTSW 2 3225623 missense probably benign 0.00
R1817:Fam171a1 UTSW 2 3178373 missense probably benign 0.04
R1869:Fam171a1 UTSW 2 3226152 missense possibly damaging 0.53
R1887:Fam171a1 UTSW 2 3220343 missense probably damaging 1.00
R2173:Fam171a1 UTSW 2 3225619 nonsense probably null
R2355:Fam171a1 UTSW 2 3225533 nonsense probably null
R3690:Fam171a1 UTSW 2 3226356 missense probably benign
R3723:Fam171a1 UTSW 2 3220375 splice site probably benign
R3978:Fam171a1 UTSW 2 3225035 missense probably benign
R4087:Fam171a1 UTSW 2 3226296 missense probably damaging 0.97
R4647:Fam171a1 UTSW 2 3220291 missense probably damaging 0.98
R4744:Fam171a1 UTSW 2 3224909 missense probably damaging 1.00
R4777:Fam171a1 UTSW 2 3223513 missense probably benign 0.03
R4786:Fam171a1 UTSW 2 3225578 missense probably damaging 1.00
R4888:Fam171a1 UTSW 2 3223509 missense probably damaging 0.98
R4982:Fam171a1 UTSW 2 3178468 splice site probably null
R5137:Fam171a1 UTSW 2 3225389 missense probably benign 0.01
R5203:Fam171a1 UTSW 2 3223545 missense probably damaging 0.99
R5233:Fam171a1 UTSW 2 3178353 missense probably damaging 1.00
R5304:Fam171a1 UTSW 2 3225617 missense probably damaging 1.00
R5475:Fam171a1 UTSW 2 3225297 missense possibly damaging 0.91
R5682:Fam171a1 UTSW 2 3226089 missense probably damaging 1.00
R5865:Fam171a1 UTSW 2 3225337 missense probably benign 0.01
R6322:Fam171a1 UTSW 2 3226355 missense probably benign 0.24
R7082:Fam171a1 UTSW 2 3223475 missense probably benign 0.00
R7141:Fam171a1 UTSW 2 3225152 nonsense probably null
R7155:Fam171a1 UTSW 2 3225729 missense probably benign 0.10
R7243:Fam171a1 UTSW 2 3118616 missense probably benign 0.07
R7326:Fam171a1 UTSW 2 3226472 nonsense probably null
R7574:Fam171a1 UTSW 2 3220354 missense probably damaging 1.00
R7745:Fam171a1 UTSW 2 3225446 missense possibly damaging 0.53
R7753:Fam171a1 UTSW 2 3178317 missense probably damaging 0.98
R7871:Fam171a1 UTSW 2 3225384 missense probably benign 0.12
R7958:Fam171a1 UTSW 2 3178261 missense probably damaging 1.00
R8677:Fam171a1 UTSW 2 3220315 missense probably damaging 0.98
R8793:Fam171a1 UTSW 2 3186498 missense probably damaging 1.00
R8850:Fam171a1 UTSW 2 3220307 missense probably damaging 1.00
R8865:Fam171a1 UTSW 2 3225903 missense probably damaging 1.00
R9016:Fam171a1 UTSW 2 3226397 missense probably benign 0.43
R9090:Fam171a1 UTSW 2 3223506 missense probably damaging 1.00
R9251:Fam171a1 UTSW 2 3225488 missense probably benign 0.06
R9271:Fam171a1 UTSW 2 3223506 missense probably damaging 1.00
R9350:Fam171a1 UTSW 2 3225000 missense probably benign 0.12
X0019:Fam171a1 UTSW 2 3225593 missense probably benign 0.19
Z1177:Fam171a1 UTSW 2 3224934 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GATCTGTCGATCACCTGGAGAG -3'
(R):5'- AAAGCTGCATCATTCAGGGATG -3'

Sequencing Primer
(F):5'- TGTCGATCACCTGGAGAGACCTAC -3'
(R):5'- TGACTCTGACATGGATGCAC -3'
Posted On 2019-10-07