Incidental Mutation 'R7477:Mylk2'
ID579530
Institutional Source Beutler Lab
Gene Symbol Mylk2
Ensembl Gene ENSMUSG00000027470
Gene Namemyosin, light polypeptide kinase 2, skeletal muscle
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.388) question?
Stock #R7477 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location152911352-152923068 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 152920341 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 511 (V511I)
Ref Sequence ENSEMBL: ENSMUSP00000028970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028970]
Predicted Effect probably damaging
Transcript: ENSMUST00000028970
AA Change: V511I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028970
Gene: ENSMUSG00000027470
AA Change: V511I

DomainStartEndE-ValueType
low complexity region 90 122 N/A INTRINSIC
low complexity region 142 157 N/A INTRINSIC
low complexity region 216 228 N/A INTRINSIC
low complexity region 278 285 N/A INTRINSIC
S_TKc 302 557 6.08e-87 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a myosin light chain kinase, a calcium/calmodulin dependent enzyme, that is exclusively expressed in adult skeletal muscle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous knockout mice display impaired skeletal muscle twitch tension response to tetanic stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 G T 5: 35,592,103 E191* probably null Het
Adam26a T A 8: 43,569,070 E461V probably damaging Het
Adamtsl1 G A 4: 86,415,651 R1539Q probably damaging Het
Adipor2 A T 6: 119,361,922 H123Q probably benign Het
Akap13 C T 7: 75,749,247 S2691L probably benign Het
Aldh1l1 T C 6: 90,598,387 probably null Het
Ankrd11 A T 8: 122,894,385 S909R possibly damaging Het
BC049730 A G 7: 24,714,248 T230A probably benign Het
Bop1 T C 15: 76,455,326 E273G probably damaging Het
Car1 G A 3: 14,776,283 H97Y probably damaging Het
Casp14 T C 10: 78,714,304 N170S probably benign Het
Ccdc158 A T 5: 92,650,696 L382M probably damaging Het
Ccdc18 A C 5: 108,220,850 Q1279H probably damaging Het
Cdh18 A G 15: 23,410,725 N432S probably benign Het
Ctdp1 T C 18: 80,440,714 probably null Het
Dhx30 A G 9: 110,087,140 I691T probably damaging Het
Dnah9 A G 11: 65,992,731 I2562T probably damaging Het
Dsp A T 13: 38,172,863 I240F probably damaging Het
Ell T C 8: 70,585,218 S308P probably benign Het
Elmo1 A G 13: 20,285,319 D26G Het
Fam171a1 T C 2: 3,225,639 V603A probably benign Het
Fam83e G A 7: 45,728,980 G476D probably damaging Het
Farp2 A G 1: 93,581,028 probably null Het
Fcer1a C T 1: 173,221,284 probably null Het
Gpr179 G T 11: 97,335,839 T1830K possibly damaging Het
Grin3a G A 4: 49,719,278 P823S probably damaging Het
Heatr4 T A 12: 83,979,830 I218F probably damaging Het
Il1f5 T A 2: 24,279,692 Y21* probably null Het
Jakmip1 A G 5: 37,173,571 T532A probably benign Het
Klf11 A G 12: 24,653,563 D16G probably benign Het
Lrp1 T A 10: 127,568,920 I1971F probably damaging Het
Lrrc9 T A 12: 72,503,527 probably null Het
Lrrk2 C T 15: 91,812,325 L2439F probably damaging Het
Mapk14 G A 17: 28,745,078 D313N probably damaging Het
Max A T 12: 76,953,186 S52T probably benign Het
Mrpl23 A G 7: 142,537,281 R80G possibly damaging Het
Muc5ac C A 7: 141,816,282 N3186K possibly damaging Het
Mypn T C 10: 63,125,721 M1031V possibly damaging Het
Nbeal1 A G 1: 60,261,584 T1488A probably benign Het
Ncbp1 A T 4: 46,157,897 E378D probably damaging Het
Nedd9 A T 13: 41,318,480 D174E probably benign Het
Nid2 T A 14: 19,805,973 D1255E probably benign Het
Nlrc3 A G 16: 3,964,811 C261R probably damaging Het
Olfr153 A G 2: 87,532,087 N18S probably benign Het
Pgam1 T A 19: 41,916,816 H196Q probably damaging Het
Pja2 A C 17: 64,309,645 V85G possibly damaging Het
Pkd2 G A 5: 104,483,242 V511M probably benign Het
Ppp2cb T A 8: 33,615,474 S171T probably benign Het
Prkab2 T C 3: 97,658,747 F45S probably damaging Het
Rabep2 A T 7: 126,444,818 probably null Het
Rnf41 T A 10: 128,435,434 I71N probably damaging Het
Slc5a7 G A 17: 54,281,759 P287S probably damaging Het
Smc6 A G 12: 11,271,807 D25G probably benign Het
Sptb A T 12: 76,628,565 L225Q probably damaging Het
Tenm4 A C 7: 96,845,808 I1148L probably damaging Het
Tnk2 C A 16: 32,677,891 probably null Het
Trank1 G A 9: 111,364,957 S683N probably benign Het
Trp53bp1 A C 2: 121,236,346 V633G probably benign Het
Ugt2a3 T C 5: 87,336,620 K182E possibly damaging Het
Uncx A T 5: 139,547,262 T361S probably benign Het
Vmn2r11 A T 5: 109,059,348 N35K possibly damaging Het
Vmn2r4 C A 3: 64,398,429 R524L probably benign Het
Vmn2r5 C T 3: 64,491,639 V640M probably damaging Het
Washc4 T C 10: 83,574,443 Y632H probably damaging Het
Xkr6 T C 14: 63,606,680 S51P possibly damaging Het
Zer1 C A 2: 30,107,976 K408N probably null Het
Znhit2 A G 19: 6,062,471 probably null Het
Other mutations in Mylk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01870:Mylk2 APN 2 152915214 missense probably benign 0.20
IGL02097:Mylk2 APN 2 152915136 missense probably damaging 0.98
IGL02158:Mylk2 APN 2 152919157 missense probably damaging 1.00
IGL02189:Mylk2 APN 2 152915154 missense probably damaging 1.00
IGL02243:Mylk2 APN 2 152920553 missense probably damaging 1.00
IGL02716:Mylk2 APN 2 152922153 makesense probably null
IGL02946:Mylk2 APN 2 152919210 nonsense probably null
IGL03105:Mylk2 APN 2 152917359 missense possibly damaging 0.94
R1184:Mylk2 UTSW 2 152913741 critical splice donor site probably null
R1443:Mylk2 UTSW 2 152919416 missense probably damaging 1.00
R1957:Mylk2 UTSW 2 152917607 missense possibly damaging 0.86
R2496:Mylk2 UTSW 2 152913668 missense probably damaging 1.00
R2870:Mylk2 UTSW 2 152919348 missense probably damaging 1.00
R2870:Mylk2 UTSW 2 152919348 missense probably damaging 1.00
R3081:Mylk2 UTSW 2 152919354 missense probably benign 0.31
R4510:Mylk2 UTSW 2 152917410 missense probably damaging 1.00
R4511:Mylk2 UTSW 2 152917410 missense probably damaging 1.00
R4600:Mylk2 UTSW 2 152917556 missense probably damaging 1.00
R4633:Mylk2 UTSW 2 152917415 missense probably benign 0.00
R4890:Mylk2 UTSW 2 152920354 missense possibly damaging 0.88
R5267:Mylk2 UTSW 2 152913549 missense probably benign
R5430:Mylk2 UTSW 2 152917548 missense probably damaging 1.00
R5447:Mylk2 UTSW 2 152912510 missense probably damaging 0.96
R6167:Mylk2 UTSW 2 152915753 splice site probably null
R6327:Mylk2 UTSW 2 152913693 missense possibly damaging 0.77
R6391:Mylk2 UTSW 2 152917395 missense probably damaging 1.00
R6913:Mylk2 UTSW 2 152913690 missense possibly damaging 0.76
R7066:Mylk2 UTSW 2 152911668 intron probably null
R7092:Mylk2 UTSW 2 152915190 missense probably benign 0.21
R7403:Mylk2 UTSW 2 152917341 missense probably damaging 1.00
R7442:Mylk2 UTSW 2 152911426 start gained probably benign
R7443:Mylk2 UTSW 2 152911426 start gained probably benign
R7453:Mylk2 UTSW 2 152912433 missense probably damaging 1.00
R7529:Mylk2 UTSW 2 152915704 missense probably damaging 1.00
R8029:Mylk2 UTSW 2 152920299 missense probably damaging 1.00
Z1177:Mylk2 UTSW 2 152920330 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCCACCCTGGGGCAGATC -3'
(R):5'- ACTCATTCTGGCACTGTGC -3'

Sequencing Primer
(F):5'- TTCACTGCAACCCTGGGAAG -3'
(R):5'- CAGAGGGCAGTGTGGTG -3'
Posted On2019-10-07