Incidental Mutation 'R7477:Car1'
ID579531
Institutional Source Beutler Lab
Gene Symbol Car1
Ensembl Gene ENSMUSG00000027556
Gene Namecarbonic anhydrase 1
SynonymsCar-1, CA I
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R7477 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location14766216-14808368 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 14776283 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 97 (H97Y)
Ref Sequence ENSEMBL: ENSMUSP00000091925 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094365] [ENSMUST00000144327] [ENSMUST00000181860]
Predicted Effect probably damaging
Transcript: ENSMUST00000094365
AA Change: H97Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091925
Gene: ENSMUSG00000027556
AA Change: H97Y

DomainStartEndE-ValueType
Carb_anhydrase 6 261 2e-133 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000144327
AA Change: H31Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120495
Gene: ENSMUSG00000027556
AA Change: H31Y

DomainStartEndE-ValueType
Carb_anhydrase 6 92 2.08e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000181860
AA Change: H97Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137926
Gene: ENSMUSG00000027556
AA Change: H97Y

DomainStartEndE-ValueType
Carb_anhydrase 6 261 2e-133 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. This CA1 gene is closely linked to the CA2 and CA3 genes on chromosome 8. It encodes a cytosolic protein that is found at the highest level in erythrocytes. Allelic variants of this gene have been described in some populations. Alternative splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: This locus controls electrophoretic variation in red blood cells. The a allele determines a slow migrating form in C57BL/6, C3H/He and other strains; the b allele determines a fast form in IS/Cam, WB/Re, SM, M. m. castaneus and M. m. molossinus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 G T 5: 35,592,103 E191* probably null Het
Adam26a T A 8: 43,569,070 E461V probably damaging Het
Adamtsl1 G A 4: 86,415,651 R1539Q probably damaging Het
Adipor2 A T 6: 119,361,922 H123Q probably benign Het
Akap13 C T 7: 75,749,247 S2691L probably benign Het
Aldh1l1 T C 6: 90,598,387 probably null Het
Ankrd11 A T 8: 122,894,385 S909R possibly damaging Het
BC049730 A G 7: 24,714,248 T230A probably benign Het
Bop1 T C 15: 76,455,326 E273G probably damaging Het
Casp14 T C 10: 78,714,304 N170S probably benign Het
Ccdc158 A T 5: 92,650,696 L382M probably damaging Het
Ccdc18 A C 5: 108,220,850 Q1279H probably damaging Het
Cdh18 A G 15: 23,410,725 N432S probably benign Het
Ctdp1 T C 18: 80,440,714 probably null Het
Dhx30 A G 9: 110,087,140 I691T probably damaging Het
Dnah9 A G 11: 65,992,731 I2562T probably damaging Het
Dsp A T 13: 38,172,863 I240F probably damaging Het
Ell T C 8: 70,585,218 S308P probably benign Het
Elmo1 A G 13: 20,285,319 D26G Het
Fam171a1 T C 2: 3,225,639 V603A probably benign Het
Fam83e G A 7: 45,728,980 G476D probably damaging Het
Farp2 A G 1: 93,581,028 probably null Het
Fcer1a C T 1: 173,221,284 probably null Het
Gpr179 G T 11: 97,335,839 T1830K possibly damaging Het
Grin3a G A 4: 49,719,278 P823S probably damaging Het
Heatr4 T A 12: 83,979,830 I218F probably damaging Het
Il1f5 T A 2: 24,279,692 Y21* probably null Het
Jakmip1 A G 5: 37,173,571 T532A probably benign Het
Klf11 A G 12: 24,653,563 D16G probably benign Het
Lrp1 T A 10: 127,568,920 I1971F probably damaging Het
Lrrc9 T A 12: 72,503,527 probably null Het
Lrrk2 C T 15: 91,812,325 L2439F probably damaging Het
Mapk14 G A 17: 28,745,078 D313N probably damaging Het
Max A T 12: 76,953,186 S52T probably benign Het
Mrpl23 A G 7: 142,537,281 R80G possibly damaging Het
Muc5ac C A 7: 141,816,282 N3186K possibly damaging Het
Mylk2 G A 2: 152,920,341 V511I probably damaging Het
Mypn T C 10: 63,125,721 M1031V possibly damaging Het
Nbeal1 A G 1: 60,261,584 T1488A probably benign Het
Ncbp1 A T 4: 46,157,897 E378D probably damaging Het
Nedd9 A T 13: 41,318,480 D174E probably benign Het
Nid2 T A 14: 19,805,973 D1255E probably benign Het
Nlrc3 A G 16: 3,964,811 C261R probably damaging Het
Olfr153 A G 2: 87,532,087 N18S probably benign Het
Pgam1 T A 19: 41,916,816 H196Q probably damaging Het
Pja2 A C 17: 64,309,645 V85G possibly damaging Het
Pkd2 G A 5: 104,483,242 V511M probably benign Het
Ppp2cb T A 8: 33,615,474 S171T probably benign Het
Prkab2 T C 3: 97,658,747 F45S probably damaging Het
Rabep2 A T 7: 126,444,818 probably null Het
Rnf41 T A 10: 128,435,434 I71N probably damaging Het
Slc5a7 G A 17: 54,281,759 P287S probably damaging Het
Smc6 A G 12: 11,271,807 D25G probably benign Het
Sptb A T 12: 76,628,565 L225Q probably damaging Het
Tenm4 A C 7: 96,845,808 I1148L probably damaging Het
Tnk2 C A 16: 32,677,891 probably null Het
Trank1 G A 9: 111,364,957 S683N probably benign Het
Trp53bp1 A C 2: 121,236,346 V633G probably benign Het
Ugt2a3 T C 5: 87,336,620 K182E possibly damaging Het
Uncx A T 5: 139,547,262 T361S probably benign Het
Vmn2r11 A T 5: 109,059,348 N35K possibly damaging Het
Vmn2r4 C A 3: 64,398,429 R524L probably benign Het
Vmn2r5 C T 3: 64,491,639 V640M probably damaging Het
Washc4 T C 10: 83,574,443 Y632H probably damaging Het
Xkr6 T C 14: 63,606,680 S51P possibly damaging Het
Zer1 C A 2: 30,107,976 K408N probably null Het
Znhit2 A G 19: 6,062,471 probably null Het
Other mutations in Car1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01749:Car1 APN 3 14767459 missense probably benign 0.00
IGL02975:Car1 APN 3 14777822 missense probably benign 0.31
R0432:Car1 UTSW 3 14770176 missense probably benign 0.03
R1637:Car1 UTSW 3 14777786 missense possibly damaging 0.81
R2244:Car1 UTSW 3 14770852 missense possibly damaging 0.50
R5036:Car1 UTSW 3 14776239 missense possibly damaging 0.86
R5038:Car1 UTSW 3 14770873 missense probably damaging 1.00
R5441:Car1 UTSW 3 14776304 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATTGCAAATTATGGTGTACTGTG -3'
(R):5'- ATAACTTTGGCACCCACTGATG -3'

Sequencing Primer
(F):5'- TTAGGCATTCATATAACGACCAGC -3'
(R):5'- GTTTATTTCCATCGTGCACAAGG -3'
Posted On2019-10-07