Incidental Mutation 'R7477:Tenm4'
ID 579551
Institutional Source Beutler Lab
Gene Symbol Tenm4
Ensembl Gene ENSMUSG00000048078
Gene Name teneurin transmembrane protein 4
Synonyms l7Rn3, Doc4, Ten-m4, ELM2, l(7)-3Rn, Odz4
MMRRC Submission 045551-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7477 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 95820453-96560300 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 96495015 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 1148 (I1148L)
Ref Sequence ENSEMBL: ENSMUSP00000102783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107162] [ENSMUST00000107165] [ENSMUST00000107166]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000107162
AA Change: I1147L

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102780
Gene: ENSMUSG00000048078
AA Change: I1147L

DomainStartEndE-ValueType
Pfam:Ten_N 10 410 5.6e-195 PFAM
transmembrane domain 411 433 N/A INTRINSIC
EGF_like 637 665 3.43e1 SMART
EGF 668 696 2.29e1 SMART
EGF 701 730 1.88e-1 SMART
EGF 733 762 1.13e1 SMART
EGF 767 797 2.39e1 SMART
EGF 800 828 4.32e-1 SMART
EGF 831 859 6.02e0 SMART
EGF 862 894 9.93e-1 SMART
low complexity region 900 914 N/A INTRINSIC
Pfam:RHS_repeat 2327 2380 5.5e-7 PFAM
Pfam:Tox-GHH 2740 2818 5.2e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107165
AA Change: I1148L

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102783
Gene: ENSMUSG00000048078
AA Change: I1148L

DomainStartEndE-ValueType
Pfam:Ten_N 36 402 1.1e-171 PFAM
transmembrane domain 403 425 N/A INTRINSIC
EGF_like 629 657 3.43e1 SMART
EGF 660 688 2.29e1 SMART
EGF 693 722 1.88e-1 SMART
EGF 725 754 1.13e1 SMART
EGF 759 789 2.39e1 SMART
EGF 792 820 4.32e-1 SMART
EGF 823 851 6.02e0 SMART
EGF 863 895 9.93e-1 SMART
low complexity region 901 915 N/A INTRINSIC
Pfam:RHS_repeat 2335 2368 1.6e-7 PFAM
Pfam:Tox-GHH 2749 2826 1.8e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107166
AA Change: I1111L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102784
Gene: ENSMUSG00000048078
AA Change: I1111L

DomainStartEndE-ValueType
Pfam:Ten_N 35 193 1.4e-83 PFAM
Pfam:Ten_N 187 365 5e-78 PFAM
transmembrane domain 366 388 N/A INTRINSIC
EGF_like 592 620 3.43e1 SMART
EGF 623 651 2.29e1 SMART
EGF 656 685 1.88e-1 SMART
EGF 688 717 1.13e1 SMART
EGF 722 752 2.39e1 SMART
EGF 755 783 4.32e-1 SMART
EGF 786 814 6.02e0 SMART
EGF 826 858 9.93e-1 SMART
low complexity region 864 878 N/A INTRINSIC
Pfam:RHS_repeat 2298 2351 3.8e-7 PFAM
Pfam:Tox-GHH 2711 2789 3.9e-34 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene plays a role in establishing proper neuronal connectivity during development. Defects in this gene have been associated with hereditary essential tremor-5. [provided by RefSeq, Oct 2016]
PHENOTYPE: Various ENU-induced alleles cause prenatal lethality associated with impaired mesoderm development and lead to pleiotropic phenotypes. The most severe alleles cause failure of gastrulation and somitogenesis while the least severe one allows survival to adulthood with runting of variable penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 G T 5: 35,749,447 (GRCm39) E191* probably null Het
Adam26a T A 8: 44,022,107 (GRCm39) E461V probably damaging Het
Adamtsl1 G A 4: 86,333,888 (GRCm39) R1539Q probably damaging Het
Adipor2 A T 6: 119,338,883 (GRCm39) H123Q probably benign Het
Akap13 C T 7: 75,398,995 (GRCm39) S2691L probably benign Het
Aldh1l1 T C 6: 90,575,369 (GRCm39) probably null Het
Ankrd11 A T 8: 123,621,124 (GRCm39) S909R possibly damaging Het
Bop1 T C 15: 76,339,526 (GRCm39) E273G probably damaging Het
Car1 G A 3: 14,841,343 (GRCm39) H97Y probably damaging Het
Casp14 T C 10: 78,550,138 (GRCm39) N170S probably benign Het
Ccdc158 A T 5: 92,798,555 (GRCm39) L382M probably damaging Het
Ccdc18 A C 5: 108,368,716 (GRCm39) Q1279H probably damaging Het
Cdh18 A G 15: 23,410,811 (GRCm39) N432S probably benign Het
Ctdp1 T C 18: 80,483,929 (GRCm39) probably null Het
Dhx30 A G 9: 109,916,208 (GRCm39) I691T probably damaging Het
Dnah9 A G 11: 65,883,557 (GRCm39) I2562T probably damaging Het
Dsp A T 13: 38,356,839 (GRCm39) I240F probably damaging Het
Ell T C 8: 71,037,868 (GRCm39) S308P probably benign Het
Elmo1 A G 13: 20,469,489 (GRCm39) D26G Het
Fam171a1 T C 2: 3,226,676 (GRCm39) V603A probably benign Het
Fam83e G A 7: 45,378,404 (GRCm39) G476D probably damaging Het
Farp2 A G 1: 93,508,750 (GRCm39) probably null Het
Fcer1a C T 1: 173,048,851 (GRCm39) probably null Het
Gpr179 G T 11: 97,226,665 (GRCm39) T1830K possibly damaging Het
Grin3a G A 4: 49,719,278 (GRCm39) P823S probably damaging Het
Heatr4 T A 12: 84,026,604 (GRCm39) I218F probably damaging Het
Il36rn T A 2: 24,169,704 (GRCm39) Y21* probably null Het
Jakmip1 A G 5: 37,330,915 (GRCm39) T532A probably benign Het
Klf11 A G 12: 24,703,562 (GRCm39) D16G probably benign Het
Lrp1 T A 10: 127,404,789 (GRCm39) I1971F probably damaging Het
Lrrc9 T A 12: 72,550,301 (GRCm39) probably null Het
Lrrk2 C T 15: 91,696,528 (GRCm39) L2439F probably damaging Het
Lypd10 A G 7: 24,413,673 (GRCm39) T230A probably benign Het
Mapk14 G A 17: 28,964,052 (GRCm39) D313N probably damaging Het
Max A T 12: 76,999,960 (GRCm39) S52T probably benign Het
Mrpl23 A G 7: 142,091,018 (GRCm39) R80G possibly damaging Het
Muc5ac C A 7: 141,370,019 (GRCm39) N3186K possibly damaging Het
Mylk2 G A 2: 152,762,261 (GRCm39) V511I probably damaging Het
Mypn T C 10: 62,961,500 (GRCm39) M1031V possibly damaging Het
Nbeal1 A G 1: 60,300,743 (GRCm39) T1488A probably benign Het
Ncbp1 A T 4: 46,157,897 (GRCm39) E378D probably damaging Het
Nedd9 A T 13: 41,471,956 (GRCm39) D174E probably benign Het
Nid2 T A 14: 19,856,041 (GRCm39) D1255E probably benign Het
Nlrc3 A G 16: 3,782,675 (GRCm39) C261R probably damaging Het
Or5w22 A G 2: 87,362,431 (GRCm39) N18S probably benign Het
Pgam1 T A 19: 41,905,255 (GRCm39) H196Q probably damaging Het
Pja2 A C 17: 64,616,640 (GRCm39) V85G possibly damaging Het
Pkd2 G A 5: 104,631,108 (GRCm39) V511M probably benign Het
Ppp2cb T A 8: 34,105,502 (GRCm39) S171T probably benign Het
Prkab2 T C 3: 97,566,063 (GRCm39) F45S probably damaging Het
Rabep2 A T 7: 126,043,990 (GRCm39) probably null Het
Rnf41 T A 10: 128,271,303 (GRCm39) I71N probably damaging Het
Slc5a7 G A 17: 54,588,787 (GRCm39) P287S probably damaging Het
Smc6 A G 12: 11,321,808 (GRCm39) D25G probably benign Het
Sptb A T 12: 76,675,339 (GRCm39) L225Q probably damaging Het
Tnk2 C A 16: 32,496,709 (GRCm39) probably null Het
Trank1 G A 9: 111,194,025 (GRCm39) S683N probably benign Het
Trp53bp1 A C 2: 121,066,827 (GRCm39) V633G probably benign Het
Ugt2a3 T C 5: 87,484,479 (GRCm39) K182E possibly damaging Het
Uncx A T 5: 139,533,017 (GRCm39) T361S probably benign Het
Vmn2r11 A T 5: 109,207,214 (GRCm39) N35K possibly damaging Het
Vmn2r4 C A 3: 64,305,850 (GRCm39) R524L probably benign Het
Vmn2r5 C T 3: 64,399,060 (GRCm39) V640M probably damaging Het
Washc4 T C 10: 83,410,307 (GRCm39) Y632H probably damaging Het
Xkr6 T C 14: 63,844,129 (GRCm39) S51P possibly damaging Het
Zer1 C A 2: 29,997,988 (GRCm39) K408N probably null Het
Znhit2 A G 19: 6,112,501 (GRCm39) probably null Het
Other mutations in Tenm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Tenm4 APN 7 96,517,216 (GRCm39) missense probably benign 0.00
IGL00468:Tenm4 APN 7 96,523,679 (GRCm39) missense probably damaging 0.98
IGL00519:Tenm4 APN 7 96,454,345 (GRCm39) splice site probably benign
IGL00979:Tenm4 APN 7 96,378,598 (GRCm39) missense probably damaging 0.96
IGL01401:Tenm4 APN 7 96,523,474 (GRCm39) missense probably damaging 1.00
IGL01459:Tenm4 APN 7 96,378,592 (GRCm39) missense probably damaging 1.00
IGL01519:Tenm4 APN 7 96,544,384 (GRCm39) missense probably damaging 1.00
IGL01545:Tenm4 APN 7 96,523,510 (GRCm39) missense probably benign 0.00
IGL01579:Tenm4 APN 7 96,512,709 (GRCm39) missense probably benign 0.00
IGL01587:Tenm4 APN 7 96,512,709 (GRCm39) missense probably benign 0.00
IGL01625:Tenm4 APN 7 96,534,565 (GRCm39) missense probably damaging 1.00
IGL01655:Tenm4 APN 7 96,202,931 (GRCm39) missense probably damaging 1.00
IGL01683:Tenm4 APN 7 96,534,611 (GRCm39) missense possibly damaging 0.84
IGL01728:Tenm4 APN 7 96,545,271 (GRCm39) missense probably damaging 1.00
IGL01732:Tenm4 APN 7 96,544,716 (GRCm39) missense probably damaging 1.00
IGL01924:Tenm4 APN 7 96,544,419 (GRCm39) missense probably damaging 1.00
IGL01966:Tenm4 APN 7 96,202,757 (GRCm39) missense probably damaging 1.00
IGL02177:Tenm4 APN 7 96,544,869 (GRCm39) missense probably benign 0.40
IGL02207:Tenm4 APN 7 96,523,323 (GRCm39) missense possibly damaging 0.85
IGL02269:Tenm4 APN 7 96,473,029 (GRCm39) missense probably damaging 1.00
IGL02274:Tenm4 APN 7 96,503,941 (GRCm39) missense probably damaging 1.00
IGL02375:Tenm4 APN 7 96,353,344 (GRCm39) missense possibly damaging 0.52
IGL02415:Tenm4 APN 7 96,523,281 (GRCm39) missense probably damaging 0.98
IGL02472:Tenm4 APN 7 96,423,383 (GRCm39) unclassified probably benign
IGL02656:Tenm4 APN 7 96,534,640 (GRCm39) missense probably damaging 1.00
IGL02678:Tenm4 APN 7 96,545,426 (GRCm39) missense probably damaging 1.00
IGL02829:Tenm4 APN 7 96,544,205 (GRCm39) nonsense probably null
IGL02863:Tenm4 APN 7 96,522,913 (GRCm39) missense probably damaging 1.00
IGL03145:Tenm4 APN 7 96,492,175 (GRCm39) missense probably damaging 0.98
IGL03153:Tenm4 APN 7 96,522,969 (GRCm39) missense probably damaging 1.00
principium UTSW 7 96,446,688 (GRCm39) missense probably damaging 0.98
toccata UTSW 7 96,552,196 (GRCm39) critical splice donor site probably null
P0026:Tenm4 UTSW 7 96,523,734 (GRCm39) missense probably damaging 1.00
R0097:Tenm4 UTSW 7 96,542,133 (GRCm39) missense probably damaging 1.00
R0097:Tenm4 UTSW 7 96,542,133 (GRCm39) missense probably damaging 1.00
R0140:Tenm4 UTSW 7 96,545,259 (GRCm39) missense possibly damaging 0.78
R0164:Tenm4 UTSW 7 96,378,547 (GRCm39) splice site probably benign
R0277:Tenm4 UTSW 7 96,344,157 (GRCm39) missense possibly damaging 0.54
R0323:Tenm4 UTSW 7 96,344,157 (GRCm39) missense possibly damaging 0.54
R0362:Tenm4 UTSW 7 96,421,242 (GRCm39) nonsense probably null
R0381:Tenm4 UTSW 7 96,555,088 (GRCm39) missense probably damaging 1.00
R0420:Tenm4 UTSW 7 96,522,973 (GRCm39) missense possibly damaging 0.85
R0426:Tenm4 UTSW 7 96,427,058 (GRCm39) missense probably damaging 1.00
R0513:Tenm4 UTSW 7 96,544,830 (GRCm39) missense probably benign 0.35
R0624:Tenm4 UTSW 7 96,423,227 (GRCm39) missense probably damaging 1.00
R0837:Tenm4 UTSW 7 96,545,482 (GRCm39) splice site probably benign
R1037:Tenm4 UTSW 7 96,446,688 (GRCm39) missense probably damaging 0.98
R1172:Tenm4 UTSW 7 96,497,251 (GRCm39) missense probably damaging 1.00
R1422:Tenm4 UTSW 7 96,199,258 (GRCm39) missense probably damaging 0.99
R1427:Tenm4 UTSW 7 96,492,255 (GRCm39) missense probably benign 0.42
R1462:Tenm4 UTSW 7 96,353,360 (GRCm39) missense probably damaging 1.00
R1462:Tenm4 UTSW 7 96,353,360 (GRCm39) missense probably damaging 1.00
R1597:Tenm4 UTSW 7 96,552,196 (GRCm39) critical splice donor site probably null
R1701:Tenm4 UTSW 7 96,552,096 (GRCm39) missense probably damaging 1.00
R1707:Tenm4 UTSW 7 96,537,892 (GRCm39) missense probably damaging 1.00
R1809:Tenm4 UTSW 7 96,522,987 (GRCm39) missense probably benign 0.17
R1812:Tenm4 UTSW 7 96,545,147 (GRCm39) missense probably damaging 1.00
R1895:Tenm4 UTSW 7 96,385,015 (GRCm39) missense probably damaging 1.00
R1933:Tenm4 UTSW 7 96,544,533 (GRCm39) missense probably damaging 1.00
R1946:Tenm4 UTSW 7 96,385,015 (GRCm39) missense probably damaging 1.00
R2108:Tenm4 UTSW 7 96,555,497 (GRCm39) missense probably damaging 1.00
R2151:Tenm4 UTSW 7 96,552,054 (GRCm39) missense probably damaging 1.00
R2247:Tenm4 UTSW 7 96,555,216 (GRCm39) missense probably benign 0.03
R2329:Tenm4 UTSW 7 96,545,069 (GRCm39) missense probably benign 0.00
R2893:Tenm4 UTSW 7 96,544,197 (GRCm39) missense probably damaging 1.00
R2990:Tenm4 UTSW 7 96,542,332 (GRCm39) splice site probably null
R3409:Tenm4 UTSW 7 96,544,367 (GRCm39) missense probably damaging 1.00
R3410:Tenm4 UTSW 7 96,501,737 (GRCm39) missense probably damaging 0.99
R3411:Tenm4 UTSW 7 96,501,737 (GRCm39) missense probably damaging 0.99
R3440:Tenm4 UTSW 7 96,202,723 (GRCm39) missense probably benign 0.00
R3441:Tenm4 UTSW 7 96,202,723 (GRCm39) missense probably benign 0.00
R3719:Tenm4 UTSW 7 96,512,770 (GRCm39) missense possibly damaging 0.92
R3772:Tenm4 UTSW 7 96,344,087 (GRCm39) missense probably damaging 1.00
R3773:Tenm4 UTSW 7 96,344,087 (GRCm39) missense probably damaging 1.00
R4093:Tenm4 UTSW 7 96,544,979 (GRCm39) missense probably damaging 1.00
R4439:Tenm4 UTSW 7 96,545,022 (GRCm39) missense probably benign 0.01
R4441:Tenm4 UTSW 7 96,545,022 (GRCm39) missense probably benign 0.01
R4510:Tenm4 UTSW 7 96,544,070 (GRCm39) missense probably benign
R4511:Tenm4 UTSW 7 96,544,070 (GRCm39) missense probably benign
R4543:Tenm4 UTSW 7 96,545,022 (GRCm39) missense probably benign 0.01
R4645:Tenm4 UTSW 7 96,544,949 (GRCm39) missense probably damaging 1.00
R4701:Tenm4 UTSW 7 96,544,556 (GRCm39) missense probably damaging 1.00
R4707:Tenm4 UTSW 7 96,423,253 (GRCm39) missense probably damaging 0.99
R4714:Tenm4 UTSW 7 96,544,131 (GRCm39) missense probably damaging 1.00
R4742:Tenm4 UTSW 7 96,446,691 (GRCm39) missense probably damaging 0.99
R4784:Tenm4 UTSW 7 96,423,253 (GRCm39) missense probably damaging 0.99
R4785:Tenm4 UTSW 7 96,423,253 (GRCm39) missense probably damaging 0.99
R4801:Tenm4 UTSW 7 96,555,452 (GRCm39) missense probably damaging 0.97
R4802:Tenm4 UTSW 7 96,555,452 (GRCm39) missense probably damaging 0.97
R4880:Tenm4 UTSW 7 96,555,025 (GRCm39) splice site probably null
R5036:Tenm4 UTSW 7 96,501,768 (GRCm39) missense probably damaging 1.00
R5036:Tenm4 UTSW 7 96,343,997 (GRCm39) missense probably damaging 1.00
R5050:Tenm4 UTSW 7 96,544,995 (GRCm39) missense probably damaging 1.00
R5103:Tenm4 UTSW 7 96,492,164 (GRCm39) missense probably damaging 1.00
R5106:Tenm4 UTSW 7 96,492,356 (GRCm39) missense probably damaging 0.99
R5118:Tenm4 UTSW 7 96,542,293 (GRCm39) missense probably damaging 1.00
R5272:Tenm4 UTSW 7 96,523,410 (GRCm39) missense probably damaging 0.98
R5282:Tenm4 UTSW 7 96,486,538 (GRCm39) missense possibly damaging 0.90
R5403:Tenm4 UTSW 7 96,538,034 (GRCm39) missense probably damaging 1.00
R5404:Tenm4 UTSW 7 96,543,887 (GRCm39) missense probably damaging 1.00
R5567:Tenm4 UTSW 7 96,545,416 (GRCm39) nonsense probably null
R5590:Tenm4 UTSW 7 96,446,608 (GRCm39) missense possibly damaging 0.93
R5590:Tenm4 UTSW 7 96,446,607 (GRCm39) missense possibly damaging 0.73
R5597:Tenm4 UTSW 7 96,202,724 (GRCm39) missense probably benign 0.00
R5782:Tenm4 UTSW 7 96,542,246 (GRCm39) missense probably benign 0.00
R5861:Tenm4 UTSW 7 96,492,424 (GRCm39) intron probably benign
R5890:Tenm4 UTSW 7 96,552,067 (GRCm39) missense probably damaging 1.00
R5930:Tenm4 UTSW 7 96,503,926 (GRCm39) missense probably damaging 1.00
R5940:Tenm4 UTSW 7 96,495,102 (GRCm39) missense probably damaging 1.00
R6012:Tenm4 UTSW 7 96,171,640 (GRCm39) intron probably benign
R6060:Tenm4 UTSW 7 96,522,918 (GRCm39) missense probably damaging 1.00
R6104:Tenm4 UTSW 7 96,486,496 (GRCm39) missense probably damaging 0.97
R6283:Tenm4 UTSW 7 96,523,701 (GRCm39) missense probably benign 0.33
R6333:Tenm4 UTSW 7 96,423,331 (GRCm39) missense probably damaging 1.00
R6522:Tenm4 UTSW 7 96,492,251 (GRCm39) missense possibly damaging 0.88
R6616:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R6746:Tenm4 UTSW 7 96,542,067 (GRCm39) missense probably damaging 1.00
R6751:Tenm4 UTSW 7 96,494,919 (GRCm39) missense possibly damaging 0.95
R6806:Tenm4 UTSW 7 96,461,166 (GRCm39) missense possibly damaging 0.95
R6807:Tenm4 UTSW 7 96,544,478 (GRCm39) missense probably damaging 1.00
R6807:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R6809:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R6810:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R6811:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R6853:Tenm4 UTSW 7 96,486,502 (GRCm39) missense possibly damaging 0.94
R6886:Tenm4 UTSW 7 96,446,599 (GRCm39) missense possibly damaging 0.85
R6920:Tenm4 UTSW 7 96,544,757 (GRCm39) missense probably damaging 1.00
R6937:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R6939:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R7011:Tenm4 UTSW 7 96,545,342 (GRCm39) nonsense probably null
R7033:Tenm4 UTSW 7 96,544,430 (GRCm39) nonsense probably null
R7040:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R7083:Tenm4 UTSW 7 96,544,556 (GRCm39) missense probably damaging 1.00
R7238:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R7239:Tenm4 UTSW 7 96,385,020 (GRCm39) missense possibly damaging 0.47
R7239:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R7337:Tenm4 UTSW 7 96,523,333 (GRCm39) missense probably benign 0.44
R7400:Tenm4 UTSW 7 96,344,010 (GRCm39) missense probably damaging 0.97
R7407:Tenm4 UTSW 7 96,423,194 (GRCm39) missense possibly damaging 0.89
R7449:Tenm4 UTSW 7 96,523,420 (GRCm39) missense possibly damaging 0.65
R7473:Tenm4 UTSW 7 96,423,353 (GRCm39) missense probably damaging 1.00
R7489:Tenm4 UTSW 7 96,486,521 (GRCm39) missense possibly damaging 0.90
R7498:Tenm4 UTSW 7 96,497,224 (GRCm39) missense probably damaging 1.00
R7562:Tenm4 UTSW 7 96,538,021 (GRCm39) missense probably damaging 1.00
R7615:Tenm4 UTSW 7 96,495,133 (GRCm39) missense probably damaging 1.00
R7624:Tenm4 UTSW 7 96,545,192 (GRCm39) missense possibly damaging 0.95
R7626:Tenm4 UTSW 7 96,542,221 (GRCm39) missense probably damaging 1.00
R7690:Tenm4 UTSW 7 96,512,740 (GRCm39) missense probably benign 0.00
R7692:Tenm4 UTSW 7 96,544,610 (GRCm39) missense probably damaging 1.00
R7748:Tenm4 UTSW 7 96,543,909 (GRCm39) missense probably damaging 1.00
R7763:Tenm4 UTSW 7 96,544,899 (GRCm39) missense probably benign 0.38
R7792:Tenm4 UTSW 7 96,423,221 (GRCm39) missense possibly damaging 0.54
R7855:Tenm4 UTSW 7 96,523,081 (GRCm39) missense probably damaging 1.00
R7868:Tenm4 UTSW 7 96,555,587 (GRCm39) missense possibly damaging 0.79
R7878:Tenm4 UTSW 7 96,501,564 (GRCm39) missense probably damaging 1.00
R7997:Tenm4 UTSW 7 96,523,512 (GRCm39) missense probably benign 0.44
R8017:Tenm4 UTSW 7 96,353,248 (GRCm39) missense probably damaging 1.00
R8019:Tenm4 UTSW 7 96,353,248 (GRCm39) missense probably damaging 1.00
R8054:Tenm4 UTSW 7 96,378,553 (GRCm39) splice site probably benign
R8061:Tenm4 UTSW 7 96,501,663 (GRCm39) missense probably damaging 1.00
R8108:Tenm4 UTSW 7 96,503,935 (GRCm39) missense probably benign 0.39
R8140:Tenm4 UTSW 7 96,544,383 (GRCm39) missense probably damaging 1.00
R8214:Tenm4 UTSW 7 96,544,614 (GRCm39) missense probably damaging 1.00
R8258:Tenm4 UTSW 7 96,517,198 (GRCm39) missense probably damaging 1.00
R8259:Tenm4 UTSW 7 96,517,198 (GRCm39) missense probably damaging 1.00
R8364:Tenm4 UTSW 7 96,421,313 (GRCm39) critical splice donor site probably null
R8542:Tenm4 UTSW 7 96,461,139 (GRCm39) missense probably damaging 0.99
R8669:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8670:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8683:Tenm4 UTSW 7 96,552,064 (GRCm39) missense probably damaging 0.99
R8691:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8692:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8714:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8716:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8735:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8736:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8737:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8738:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8738:Tenm4 UTSW 7 96,523,047 (GRCm39) missense probably damaging 1.00
R8739:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8776:Tenm4 UTSW 7 96,544,239 (GRCm39) missense probably damaging 1.00
R8776-TAIL:Tenm4 UTSW 7 96,544,239 (GRCm39) missense probably damaging 1.00
R8777:Tenm4 UTSW 7 96,545,244 (GRCm39) missense probably damaging 1.00
R8777-TAIL:Tenm4 UTSW 7 96,545,244 (GRCm39) missense probably damaging 1.00
R8817:Tenm4 UTSW 7 96,523,335 (GRCm39) missense probably benign 0.01
R8851:Tenm4 UTSW 7 96,501,710 (GRCm39) missense probably damaging 1.00
R8913:Tenm4 UTSW 7 96,351,952 (GRCm39) splice site probably benign
R8977:Tenm4 UTSW 7 96,461,177 (GRCm39) missense probably damaging 1.00
R9100:Tenm4 UTSW 7 96,495,061 (GRCm39) missense probably damaging 1.00
R9136:Tenm4 UTSW 7 96,473,125 (GRCm39) missense possibly damaging 0.69
R9163:Tenm4 UTSW 7 96,473,080 (GRCm39) missense probably damaging 1.00
R9188:Tenm4 UTSW 7 96,421,234 (GRCm39) missense probably damaging 1.00
R9195:Tenm4 UTSW 7 96,542,126 (GRCm39) missense probably damaging 1.00
R9217:Tenm4 UTSW 7 96,534,646 (GRCm39) missense probably damaging 1.00
R9344:Tenm4 UTSW 7 96,545,352 (GRCm39) missense probably damaging 1.00
R9414:Tenm4 UTSW 7 96,545,367 (GRCm39) missense probably benign
R9466:Tenm4 UTSW 7 96,199,252 (GRCm39) missense possibly damaging 0.79
R9559:Tenm4 UTSW 7 96,473,056 (GRCm39) missense probably benign
R9626:Tenm4 UTSW 7 96,545,345 (GRCm39) missense probably damaging 1.00
R9673:Tenm4 UTSW 7 96,517,196 (GRCm39) missense probably damaging 1.00
R9676:Tenm4 UTSW 7 96,544,638 (GRCm39) missense probably damaging 1.00
R9678:Tenm4 UTSW 7 96,386,619 (GRCm39) missense possibly damaging 0.94
R9775:Tenm4 UTSW 7 96,555,761 (GRCm39) missense possibly damaging 0.92
R9790:Tenm4 UTSW 7 96,538,046 (GRCm39) missense probably damaging 1.00
R9791:Tenm4 UTSW 7 96,538,046 (GRCm39) missense probably damaging 1.00
R9803:Tenm4 UTSW 7 96,202,685 (GRCm39) missense probably damaging 1.00
X0021:Tenm4 UTSW 7 96,523,116 (GRCm39) nonsense probably null
X0026:Tenm4 UTSW 7 96,517,294 (GRCm39) missense probably damaging 0.98
X0066:Tenm4 UTSW 7 96,544,001 (GRCm39) missense probably damaging 1.00
X0066:Tenm4 UTSW 7 96,497,237 (GRCm39) missense probably damaging 1.00
Z1176:Tenm4 UTSW 7 96,555,121 (GRCm39) missense probably benign 0.00
Z1177:Tenm4 UTSW 7 96,512,792 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGGCCTTGGATGTCACTTCC -3'
(R):5'- AAGCCCTAGCAGGTTTTGACC -3'

Sequencing Primer
(F):5'- TGGATGTCACTTCCCCCAGG -3'
(R):5'- CACTGTGTGGAACCTGTGTCAC -3'
Posted On 2019-10-07