Incidental Mutation 'R7477:Heatr4'
ID579573
Institutional Source Beutler Lab
Gene Symbol Heatr4
Ensembl Gene ENSMUSG00000090843
Gene NameHEAT repeat containing 4
SynonymsGm17673
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R7477 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location83954499-83984852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83979830 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 218 (I218F)
Ref Sequence ENSEMBL: ENSMUSP00000129832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164935]
Predicted Effect probably damaging
Transcript: ENSMUST00000164935
AA Change: I218F

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129832
Gene: ENSMUSG00000090843
AA Change: I218F

DomainStartEndE-ValueType
low complexity region 153 166 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
low complexity region 289 303 N/A INTRINSIC
low complexity region 533 548 N/A INTRINSIC
internal_repeat_1 577 711 2.78e-6 PROSPERO
Pfam:HEAT_2 776 890 1.8e-8 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 G T 5: 35,592,103 E191* probably null Het
Adam26a T A 8: 43,569,070 E461V probably damaging Het
Adamtsl1 G A 4: 86,415,651 R1539Q probably damaging Het
Adipor2 A T 6: 119,361,922 H123Q probably benign Het
Akap13 C T 7: 75,749,247 S2691L probably benign Het
Aldh1l1 T C 6: 90,598,387 probably null Het
Ankrd11 A T 8: 122,894,385 S909R possibly damaging Het
BC049730 A G 7: 24,714,248 T230A probably benign Het
Bop1 T C 15: 76,455,326 E273G probably damaging Het
Car1 G A 3: 14,776,283 H97Y probably damaging Het
Casp14 T C 10: 78,714,304 N170S probably benign Het
Ccdc158 A T 5: 92,650,696 L382M probably damaging Het
Ccdc18 A C 5: 108,220,850 Q1279H probably damaging Het
Cdh18 A G 15: 23,410,725 N432S probably benign Het
Ctdp1 T C 18: 80,440,714 probably null Het
Dhx30 A G 9: 110,087,140 I691T probably damaging Het
Dnah9 A G 11: 65,992,731 I2562T probably damaging Het
Dsp A T 13: 38,172,863 I240F probably damaging Het
Ell T C 8: 70,585,218 S308P probably benign Het
Elmo1 A G 13: 20,285,319 D26G Het
Fam171a1 T C 2: 3,225,639 V603A probably benign Het
Fam83e G A 7: 45,728,980 G476D probably damaging Het
Farp2 A G 1: 93,581,028 probably null Het
Fcer1a C T 1: 173,221,284 probably null Het
Gpr179 G T 11: 97,335,839 T1830K possibly damaging Het
Grin3a G A 4: 49,719,278 P823S probably damaging Het
Il1f5 T A 2: 24,279,692 Y21* probably null Het
Jakmip1 A G 5: 37,173,571 T532A probably benign Het
Klf11 A G 12: 24,653,563 D16G probably benign Het
Lrp1 T A 10: 127,568,920 I1971F probably damaging Het
Lrrc9 T A 12: 72,503,527 probably null Het
Lrrk2 C T 15: 91,812,325 L2439F probably damaging Het
Mapk14 G A 17: 28,745,078 D313N probably damaging Het
Max A T 12: 76,953,186 S52T probably benign Het
Mrpl23 A G 7: 142,537,281 R80G possibly damaging Het
Muc5ac C A 7: 141,816,282 N3186K possibly damaging Het
Mylk2 G A 2: 152,920,341 V511I probably damaging Het
Mypn T C 10: 63,125,721 M1031V possibly damaging Het
Nbeal1 A G 1: 60,261,584 T1488A probably benign Het
Ncbp1 A T 4: 46,157,897 E378D probably damaging Het
Nedd9 A T 13: 41,318,480 D174E probably benign Het
Nid2 T A 14: 19,805,973 D1255E probably benign Het
Nlrc3 A G 16: 3,964,811 C261R probably damaging Het
Olfr153 A G 2: 87,532,087 N18S probably benign Het
Pgam1 T A 19: 41,916,816 H196Q probably damaging Het
Pja2 A C 17: 64,309,645 V85G possibly damaging Het
Pkd2 G A 5: 104,483,242 V511M probably benign Het
Ppp2cb T A 8: 33,615,474 S171T probably benign Het
Prkab2 T C 3: 97,658,747 F45S probably damaging Het
Rabep2 A T 7: 126,444,818 probably null Het
Rnf41 T A 10: 128,435,434 I71N probably damaging Het
Slc5a7 G A 17: 54,281,759 P287S probably damaging Het
Smc6 A G 12: 11,271,807 D25G probably benign Het
Sptb A T 12: 76,628,565 L225Q probably damaging Het
Tenm4 A C 7: 96,845,808 I1148L probably damaging Het
Tnk2 C A 16: 32,677,891 probably null Het
Trank1 G A 9: 111,364,957 S683N probably benign Het
Trp53bp1 A C 2: 121,236,346 V633G probably benign Het
Ugt2a3 T C 5: 87,336,620 K182E possibly damaging Het
Uncx A T 5: 139,547,262 T361S probably benign Het
Vmn2r11 A T 5: 109,059,348 N35K possibly damaging Het
Vmn2r4 C A 3: 64,398,429 R524L probably benign Het
Vmn2r5 C T 3: 64,491,639 V640M probably damaging Het
Washc4 T C 10: 83,574,443 Y632H probably damaging Het
Xkr6 T C 14: 63,606,680 S51P possibly damaging Het
Zer1 C A 2: 30,107,976 K408N probably null Het
Znhit2 A G 19: 6,062,471 probably null Het
Other mutations in Heatr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1070:Heatr4 UTSW 12 83978067 missense possibly damaging 0.70
R1225:Heatr4 UTSW 12 83978046 missense probably benign 0.01
R1398:Heatr4 UTSW 12 83967621 missense possibly damaging 0.45
R1467:Heatr4 UTSW 12 83978067 missense possibly damaging 0.70
R1467:Heatr4 UTSW 12 83978067 missense possibly damaging 0.70
R1626:Heatr4 UTSW 12 83973721 missense probably benign 0.00
R1728:Heatr4 UTSW 12 83967572 missense probably benign 0.03
R1779:Heatr4 UTSW 12 83980160 missense probably benign 0.30
R1784:Heatr4 UTSW 12 83967572 missense probably benign 0.03
R1860:Heatr4 UTSW 12 83979728 nonsense probably null
R1903:Heatr4 UTSW 12 83958447 missense probably damaging 1.00
R1916:Heatr4 UTSW 12 83955817 missense probably benign 0.21
R1972:Heatr4 UTSW 12 83955020 missense probably damaging 1.00
R2008:Heatr4 UTSW 12 83979740 missense probably benign 0.01
R2081:Heatr4 UTSW 12 83980322 missense probably damaging 0.99
R2093:Heatr4 UTSW 12 83975081 missense possibly damaging 0.63
R2399:Heatr4 UTSW 12 83980333 missense probably benign 0.00
R2680:Heatr4 UTSW 12 83980463 missense possibly damaging 0.91
R4618:Heatr4 UTSW 12 83978067 missense probably damaging 1.00
R6400:Heatr4 UTSW 12 83955010 missense probably null 1.00
R6527:Heatr4 UTSW 12 83979763 missense probably damaging 1.00
R6616:Heatr4 UTSW 12 83980130 missense probably benign
R6815:Heatr4 UTSW 12 83979727 missense probably damaging 0.96
R7070:Heatr4 UTSW 12 83969858 missense probably benign
R7219:Heatr4 UTSW 12 83957870 missense possibly damaging 0.89
R7329:Heatr4 UTSW 12 83978082 missense probably benign 0.00
R7570:Heatr4 UTSW 12 83979644 missense probably benign 0.10
R7709:Heatr4 UTSW 12 83957725 missense probably damaging 0.98
Z1177:Heatr4 UTSW 12 83980478 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGCATTTTGAGGAGCTCCAAG -3'
(R):5'- ACTTCTTGCCGGAAGACTTCAC -3'

Sequencing Primer
(F):5'- CATTTTGAGGAGCTCCAAGTCACTG -3'
(R):5'- GCCGGAAGACTTCACTTACTTGG -3'
Posted On2019-10-07