Incidental Mutation 'R7477:Dsp'
ID 579575
Institutional Source Beutler Lab
Gene Symbol Dsp
Ensembl Gene ENSMUSG00000054889
Gene Name desmoplakin
Synonyms DP, 2300002E22Rik, 5730453H04Rik, rul
MMRRC Submission 045551-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7477 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 38335270-38382553 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 38356839 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 240 (I240F)
Ref Sequence ENSEMBL: ENSMUSP00000115062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124830] [ENSMUST00000127906]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000124830
AA Change: I240F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115062
Gene: ENSMUSG00000054889
AA Change: I240F

DomainStartEndE-ValueType
Blast:SPEC 193 282 2e-51 BLAST
SPEC 285 385 6.03e-2 SMART
Blast:SPEC 391 557 1e-96 BLAST
Blast:SPEC 783 894 4e-34 BLAST
SPEC 901 1030 1.39e0 SMART
coiled coil region 1033 1370 N/A INTRINSIC
coiled coil region 1394 1956 N/A INTRINSIC
low complexity region 1997 2011 N/A INTRINSIC
PLEC 2021 2057 3.33e-1 SMART
PLEC 2058 2095 3.76e-9 SMART
PLEC 2096 2133 4.09e-10 SMART
PLEC 2134 2171 2.09e-7 SMART
PLEC 2175 2209 4.83e1 SMART
PLEC 2210 2245 5.67e1 SMART
PLEC 2263 2300 1.22e-8 SMART
PLEC 2301 2338 1.16e-9 SMART
PLEC 2339 2376 1.12e-7 SMART
PLEC 2377 2414 1.56e-6 SMART
PLEC 2418 2452 1.42e0 SMART
PLEC 2468 2505 3.7e-8 SMART
low complexity region 2507 2517 N/A INTRINSIC
PLEC 2519 2556 3.73e-4 SMART
low complexity region 2577 2593 N/A INTRINSIC
PLEC 2622 2659 1.46e-6 SMART
PLEC 2660 2697 6.69e-15 SMART
PLEC 2698 2735 1.98e2 SMART
PLEC 2736 2773 2.35e-10 SMART
PLEC 2774 2811 1.39e-3 SMART
low complexity region 2835 2860 N/A INTRINSIC
low complexity region 2867 2879 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000127906
AA Change: I240F

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117252
Gene: ENSMUSG00000054889
AA Change: I240F

DomainStartEndE-ValueType
Blast:SPEC 193 282 2e-51 BLAST
SPEC 285 385 6.03e-2 SMART
Blast:SPEC 391 557 1e-95 BLAST
Blast:SPEC 783 894 3e-34 BLAST
SPEC 901 1030 1.39e0 SMART
coiled coil region 1033 1357 N/A INTRINSIC
low complexity region 1398 1412 N/A INTRINSIC
PLEC 1422 1458 3.33e-1 SMART
PLEC 1459 1496 3.76e-9 SMART
PLEC 1497 1534 4.09e-10 SMART
PLEC 1535 1572 2.09e-7 SMART
PLEC 1576 1610 4.83e1 SMART
PLEC 1611 1646 5.67e1 SMART
PLEC 1664 1701 1.22e-8 SMART
PLEC 1702 1739 1.16e-9 SMART
PLEC 1740 1777 1.12e-7 SMART
PLEC 1778 1815 1.56e-6 SMART
PLEC 1819 1853 1.42e0 SMART
PLEC 1869 1906 3.7e-8 SMART
low complexity region 1908 1918 N/A INTRINSIC
PLEC 1920 1957 3.73e-4 SMART
low complexity region 1978 1994 N/A INTRINSIC
PLEC 2023 2060 1.46e-6 SMART
PLEC 2061 2098 6.69e-15 SMART
PLEC 2099 2136 1.98e2 SMART
PLEC 2137 2174 2.35e-10 SMART
PLEC 2175 2212 1.39e-3 SMART
low complexity region 2236 2261 N/A INTRINSIC
low complexity region 2268 2280 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that anchors intermediate filaments to desmosomal plaques and forms an obligate component of functional desmosomes. Mutations in this gene are the cause of several cardiomyopathies and keratodermas, including skin fragility-woolly hair syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous targeted null mutants die by embryonic day E6.5 due to instability of desmosomes and tissue integrity; rescue by aggregation with wild-type tetraploid morulae increase embyronic survival with noted major defects in heart muscle, neuroepithelium and epidermis; conditional knockouts that are epidermal-specific have compositionally altered epidermal desmosomes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 G T 5: 35,749,447 (GRCm39) E191* probably null Het
Adam26a T A 8: 44,022,107 (GRCm39) E461V probably damaging Het
Adamtsl1 G A 4: 86,333,888 (GRCm39) R1539Q probably damaging Het
Adipor2 A T 6: 119,338,883 (GRCm39) H123Q probably benign Het
Akap13 C T 7: 75,398,995 (GRCm39) S2691L probably benign Het
Aldh1l1 T C 6: 90,575,369 (GRCm39) probably null Het
Ankrd11 A T 8: 123,621,124 (GRCm39) S909R possibly damaging Het
Bop1 T C 15: 76,339,526 (GRCm39) E273G probably damaging Het
Car1 G A 3: 14,841,343 (GRCm39) H97Y probably damaging Het
Casp14 T C 10: 78,550,138 (GRCm39) N170S probably benign Het
Ccdc158 A T 5: 92,798,555 (GRCm39) L382M probably damaging Het
Ccdc18 A C 5: 108,368,716 (GRCm39) Q1279H probably damaging Het
Cdh18 A G 15: 23,410,811 (GRCm39) N432S probably benign Het
Ctdp1 T C 18: 80,483,929 (GRCm39) probably null Het
Dhx30 A G 9: 109,916,208 (GRCm39) I691T probably damaging Het
Dnah9 A G 11: 65,883,557 (GRCm39) I2562T probably damaging Het
Ell T C 8: 71,037,868 (GRCm39) S308P probably benign Het
Elmo1 A G 13: 20,469,489 (GRCm39) D26G Het
Fam171a1 T C 2: 3,226,676 (GRCm39) V603A probably benign Het
Fam83e G A 7: 45,378,404 (GRCm39) G476D probably damaging Het
Farp2 A G 1: 93,508,750 (GRCm39) probably null Het
Fcer1a C T 1: 173,048,851 (GRCm39) probably null Het
Gpr179 G T 11: 97,226,665 (GRCm39) T1830K possibly damaging Het
Grin3a G A 4: 49,719,278 (GRCm39) P823S probably damaging Het
Heatr4 T A 12: 84,026,604 (GRCm39) I218F probably damaging Het
Il36rn T A 2: 24,169,704 (GRCm39) Y21* probably null Het
Jakmip1 A G 5: 37,330,915 (GRCm39) T532A probably benign Het
Klf11 A G 12: 24,703,562 (GRCm39) D16G probably benign Het
Lrp1 T A 10: 127,404,789 (GRCm39) I1971F probably damaging Het
Lrrc9 T A 12: 72,550,301 (GRCm39) probably null Het
Lrrk2 C T 15: 91,696,528 (GRCm39) L2439F probably damaging Het
Lypd10 A G 7: 24,413,673 (GRCm39) T230A probably benign Het
Mapk14 G A 17: 28,964,052 (GRCm39) D313N probably damaging Het
Max A T 12: 76,999,960 (GRCm39) S52T probably benign Het
Mrpl23 A G 7: 142,091,018 (GRCm39) R80G possibly damaging Het
Muc5ac C A 7: 141,370,019 (GRCm39) N3186K possibly damaging Het
Mylk2 G A 2: 152,762,261 (GRCm39) V511I probably damaging Het
Mypn T C 10: 62,961,500 (GRCm39) M1031V possibly damaging Het
Nbeal1 A G 1: 60,300,743 (GRCm39) T1488A probably benign Het
Ncbp1 A T 4: 46,157,897 (GRCm39) E378D probably damaging Het
Nedd9 A T 13: 41,471,956 (GRCm39) D174E probably benign Het
Nid2 T A 14: 19,856,041 (GRCm39) D1255E probably benign Het
Nlrc3 A G 16: 3,782,675 (GRCm39) C261R probably damaging Het
Or5w22 A G 2: 87,362,431 (GRCm39) N18S probably benign Het
Pgam1 T A 19: 41,905,255 (GRCm39) H196Q probably damaging Het
Pja2 A C 17: 64,616,640 (GRCm39) V85G possibly damaging Het
Pkd2 G A 5: 104,631,108 (GRCm39) V511M probably benign Het
Ppp2cb T A 8: 34,105,502 (GRCm39) S171T probably benign Het
Prkab2 T C 3: 97,566,063 (GRCm39) F45S probably damaging Het
Rabep2 A T 7: 126,043,990 (GRCm39) probably null Het
Rnf41 T A 10: 128,271,303 (GRCm39) I71N probably damaging Het
Slc5a7 G A 17: 54,588,787 (GRCm39) P287S probably damaging Het
Smc6 A G 12: 11,321,808 (GRCm39) D25G probably benign Het
Sptb A T 12: 76,675,339 (GRCm39) L225Q probably damaging Het
Tenm4 A C 7: 96,495,015 (GRCm39) I1148L probably damaging Het
Tnk2 C A 16: 32,496,709 (GRCm39) probably null Het
Trank1 G A 9: 111,194,025 (GRCm39) S683N probably benign Het
Trp53bp1 A C 2: 121,066,827 (GRCm39) V633G probably benign Het
Ugt2a3 T C 5: 87,484,479 (GRCm39) K182E possibly damaging Het
Uncx A T 5: 139,533,017 (GRCm39) T361S probably benign Het
Vmn2r11 A T 5: 109,207,214 (GRCm39) N35K possibly damaging Het
Vmn2r4 C A 3: 64,305,850 (GRCm39) R524L probably benign Het
Vmn2r5 C T 3: 64,399,060 (GRCm39) V640M probably damaging Het
Washc4 T C 10: 83,410,307 (GRCm39) Y632H probably damaging Het
Xkr6 T C 14: 63,844,129 (GRCm39) S51P possibly damaging Het
Zer1 C A 2: 29,997,988 (GRCm39) K408N probably null Het
Znhit2 A G 19: 6,112,501 (GRCm39) probably null Het
Other mutations in Dsp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Dsp APN 13 38,381,822 (GRCm39) missense probably damaging 0.99
IGL01337:Dsp APN 13 38,376,663 (GRCm39) missense probably benign 0.44
IGL01371:Dsp APN 13 38,377,593 (GRCm39) missense probably benign 0.13
IGL01473:Dsp APN 13 38,351,547 (GRCm39) missense probably damaging 0.99
IGL01660:Dsp APN 13 38,360,471 (GRCm39) missense possibly damaging 0.90
IGL01723:Dsp APN 13 38,363,060 (GRCm39) missense probably damaging 1.00
IGL01999:Dsp APN 13 38,365,162 (GRCm39) missense probably damaging 0.99
IGL02313:Dsp APN 13 38,380,499 (GRCm39) nonsense probably null
IGL02833:Dsp APN 13 38,376,897 (GRCm39) missense possibly damaging 0.56
IGL03050:Dsp APN 13 38,372,421 (GRCm39) splice site probably benign
IGL03353:Dsp APN 13 38,370,671 (GRCm39) missense probably damaging 1.00
R0052:Dsp UTSW 13 38,381,340 (GRCm39) missense possibly damaging 0.93
R0052:Dsp UTSW 13 38,381,340 (GRCm39) missense possibly damaging 0.93
R0078:Dsp UTSW 13 38,379,993 (GRCm39) missense probably benign 0.22
R0230:Dsp UTSW 13 38,381,681 (GRCm39) missense probably benign 0.03
R0234:Dsp UTSW 13 38,371,869 (GRCm39) missense probably benign 0.13
R0234:Dsp UTSW 13 38,371,869 (GRCm39) missense probably benign 0.13
R0285:Dsp UTSW 13 38,356,770 (GRCm39) missense probably benign
R0326:Dsp UTSW 13 38,376,846 (GRCm39) nonsense probably null
R0332:Dsp UTSW 13 38,366,204 (GRCm39) nonsense probably null
R0471:Dsp UTSW 13 38,377,326 (GRCm39) nonsense probably null
R0567:Dsp UTSW 13 38,376,414 (GRCm39) missense probably benign 0.01
R0611:Dsp UTSW 13 38,371,717 (GRCm39) missense probably damaging 1.00
R0718:Dsp UTSW 13 38,380,740 (GRCm39) missense possibly damaging 0.80
R0926:Dsp UTSW 13 38,367,194 (GRCm39) missense probably damaging 0.97
R1078:Dsp UTSW 13 38,367,082 (GRCm39) splice site probably benign
R1183:Dsp UTSW 13 38,375,716 (GRCm39) nonsense probably null
R1188:Dsp UTSW 13 38,378,939 (GRCm39) missense probably damaging 1.00
R1419:Dsp UTSW 13 38,370,671 (GRCm39) missense probably damaging 1.00
R1445:Dsp UTSW 13 38,375,907 (GRCm39) missense probably damaging 0.98
R1467:Dsp UTSW 13 38,376,688 (GRCm39) missense probably benign 0.00
R1467:Dsp UTSW 13 38,376,688 (GRCm39) missense probably benign 0.00
R1478:Dsp UTSW 13 38,365,114 (GRCm39) missense probably damaging 1.00
R1568:Dsp UTSW 13 38,359,123 (GRCm39) missense probably damaging 1.00
R1572:Dsp UTSW 13 38,379,714 (GRCm39) missense probably damaging 1.00
R1676:Dsp UTSW 13 38,377,350 (GRCm39) nonsense probably null
R1736:Dsp UTSW 13 38,376,966 (GRCm39) missense probably benign 0.01
R1776:Dsp UTSW 13 38,380,593 (GRCm39) missense probably damaging 0.99
R1829:Dsp UTSW 13 38,377,171 (GRCm39) missense probably damaging 1.00
R1878:Dsp UTSW 13 38,348,831 (GRCm39) missense possibly damaging 0.53
R2013:Dsp UTSW 13 38,375,434 (GRCm39) missense probably damaging 1.00
R2161:Dsp UTSW 13 38,380,427 (GRCm39) missense probably damaging 1.00
R2187:Dsp UTSW 13 38,360,383 (GRCm39) missense probably damaging 1.00
R2295:Dsp UTSW 13 38,381,022 (GRCm39) missense probably benign 0.28
R2495:Dsp UTSW 13 38,377,453 (GRCm39) missense possibly damaging 0.91
R2566:Dsp UTSW 13 38,380,380 (GRCm39) missense probably damaging 1.00
R2888:Dsp UTSW 13 38,376,224 (GRCm39) missense possibly damaging 0.92
R3012:Dsp UTSW 13 38,377,318 (GRCm39) missense possibly damaging 0.61
R3614:Dsp UTSW 13 38,361,175 (GRCm39) missense probably damaging 0.98
R3725:Dsp UTSW 13 38,381,594 (GRCm39) missense probably benign 0.00
R3725:Dsp UTSW 13 38,378,665 (GRCm39) splice site probably null
R3797:Dsp UTSW 13 38,361,260 (GRCm39) critical splice donor site probably null
R3841:Dsp UTSW 13 38,381,681 (GRCm39) missense probably benign
R4030:Dsp UTSW 13 38,375,404 (GRCm39) missense possibly damaging 0.84
R4124:Dsp UTSW 13 38,370,689 (GRCm39) missense probably damaging 1.00
R4279:Dsp UTSW 13 38,369,207 (GRCm39) missense probably damaging 1.00
R4334:Dsp UTSW 13 38,380,640 (GRCm39) missense possibly damaging 0.46
R4419:Dsp UTSW 13 38,379,108 (GRCm39) missense probably damaging 1.00
R4615:Dsp UTSW 13 38,375,608 (GRCm39) missense probably damaging 0.98
R4627:Dsp UTSW 13 38,352,617 (GRCm39) missense probably benign 0.01
R4639:Dsp UTSW 13 38,380,760 (GRCm39) missense probably damaging 1.00
R4687:Dsp UTSW 13 38,375,595 (GRCm39) missense probably damaging 1.00
R4735:Dsp UTSW 13 38,380,016 (GRCm39) missense probably damaging 0.99
R4746:Dsp UTSW 13 38,379,080 (GRCm39) missense possibly damaging 0.51
R4772:Dsp UTSW 13 38,351,504 (GRCm39) nonsense probably null
R4830:Dsp UTSW 13 38,376,840 (GRCm39) missense probably benign
R4850:Dsp UTSW 13 38,376,445 (GRCm39) missense probably damaging 1.00
R4959:Dsp UTSW 13 38,375,686 (GRCm39) missense probably benign 0.41
R4963:Dsp UTSW 13 38,381,846 (GRCm39) missense probably damaging 0.99
R4969:Dsp UTSW 13 38,376,886 (GRCm39) missense probably benign 0.00
R4978:Dsp UTSW 13 38,366,210 (GRCm39) missense probably damaging 1.00
R4989:Dsp UTSW 13 38,381,678 (GRCm39) missense possibly damaging 0.93
R5068:Dsp UTSW 13 38,381,099 (GRCm39) missense possibly damaging 0.78
R5069:Dsp UTSW 13 38,381,099 (GRCm39) missense possibly damaging 0.78
R5070:Dsp UTSW 13 38,381,099 (GRCm39) missense possibly damaging 0.78
R5133:Dsp UTSW 13 38,381,678 (GRCm39) missense possibly damaging 0.93
R5138:Dsp UTSW 13 38,379,821 (GRCm39) missense possibly damaging 0.50
R5138:Dsp UTSW 13 38,367,274 (GRCm39) missense probably benign 0.37
R5153:Dsp UTSW 13 38,366,282 (GRCm39) missense probably damaging 1.00
R5199:Dsp UTSW 13 38,376,878 (GRCm39) nonsense probably null
R5226:Dsp UTSW 13 38,370,746 (GRCm39) missense probably damaging 0.99
R5265:Dsp UTSW 13 38,379,159 (GRCm39) missense possibly damaging 0.95
R5371:Dsp UTSW 13 38,378,865 (GRCm39) missense probably damaging 0.97
R5484:Dsp UTSW 13 38,368,014 (GRCm39) missense possibly damaging 0.48
R5534:Dsp UTSW 13 38,379,818 (GRCm39) missense probably benign 0.01
R5569:Dsp UTSW 13 38,376,628 (GRCm39) missense probably benign 0.01
R5854:Dsp UTSW 13 38,351,477 (GRCm39) splice site probably null
R5910:Dsp UTSW 13 38,376,445 (GRCm39) missense possibly damaging 0.95
R5929:Dsp UTSW 13 38,379,410 (GRCm39) missense possibly damaging 0.92
R5940:Dsp UTSW 13 38,380,002 (GRCm39) missense possibly damaging 0.70
R5948:Dsp UTSW 13 38,379,377 (GRCm39) missense possibly damaging 0.95
R5955:Dsp UTSW 13 38,378,934 (GRCm39) missense possibly damaging 0.73
R5970:Dsp UTSW 13 38,379,678 (GRCm39) missense possibly damaging 0.93
R6054:Dsp UTSW 13 38,351,585 (GRCm39) missense probably benign 0.00
R6113:Dsp UTSW 13 38,376,023 (GRCm39) missense probably damaging 1.00
R6139:Dsp UTSW 13 38,376,382 (GRCm39) missense probably damaging 0.97
R6328:Dsp UTSW 13 38,380,982 (GRCm39) nonsense probably null
R6527:Dsp UTSW 13 38,379,849 (GRCm39) missense probably damaging 1.00
R6573:Dsp UTSW 13 38,380,838 (GRCm39) missense probably damaging 1.00
R6628:Dsp UTSW 13 38,351,598 (GRCm39) missense possibly damaging 0.73
R6738:Dsp UTSW 13 38,376,186 (GRCm39) missense possibly damaging 0.87
R6898:Dsp UTSW 13 38,376,193 (GRCm39) missense possibly damaging 0.59
R6919:Dsp UTSW 13 38,351,631 (GRCm39) missense possibly damaging 0.84
R6951:Dsp UTSW 13 38,351,622 (GRCm39) missense possibly damaging 0.95
R7017:Dsp UTSW 13 38,370,683 (GRCm39) missense probably benign 0.02
R7022:Dsp UTSW 13 38,375,716 (GRCm39) missense probably benign 0.06
R7135:Dsp UTSW 13 38,363,049 (GRCm39) missense probably damaging 1.00
R7192:Dsp UTSW 13 38,379,569 (GRCm39) missense probably benign 0.09
R7211:Dsp UTSW 13 38,372,511 (GRCm39) critical splice donor site probably null
R7251:Dsp UTSW 13 38,377,524 (GRCm39) missense probably benign 0.02
R7326:Dsp UTSW 13 38,376,859 (GRCm39) missense probably benign 0.01
R7369:Dsp UTSW 13 38,381,501 (GRCm39) missense possibly damaging 0.82
R7376:Dsp UTSW 13 38,356,819 (GRCm39) missense probably damaging 1.00
R7406:Dsp UTSW 13 38,381,172 (GRCm39) missense possibly damaging 0.63
R7439:Dsp UTSW 13 38,379,425 (GRCm39) missense probably benign 0.00
R7439:Dsp UTSW 13 38,360,478 (GRCm39) critical splice donor site probably null
R7441:Dsp UTSW 13 38,379,425 (GRCm39) missense probably benign 0.00
R7535:Dsp UTSW 13 38,376,765 (GRCm39) missense probably benign 0.05
R7558:Dsp UTSW 13 38,352,742 (GRCm39) missense probably benign 0.02
R7600:Dsp UTSW 13 38,375,691 (GRCm39) missense probably damaging 1.00
R7616:Dsp UTSW 13 38,375,458 (GRCm39) missense probably damaging 0.98
R7702:Dsp UTSW 13 38,359,183 (GRCm39) missense possibly damaging 0.83
R7738:Dsp UTSW 13 38,369,151 (GRCm39) missense probably damaging 0.97
R7815:Dsp UTSW 13 38,375,446 (GRCm39) missense probably benign 0.31
R7882:Dsp UTSW 13 38,367,994 (GRCm39) missense possibly damaging 0.76
R7917:Dsp UTSW 13 38,351,615 (GRCm39) nonsense probably null
R7971:Dsp UTSW 13 38,376,499 (GRCm39) missense probably damaging 0.97
R8104:Dsp UTSW 13 38,352,600 (GRCm39) missense probably benign 0.03
R8176:Dsp UTSW 13 38,376,786 (GRCm39) missense possibly damaging 0.56
R8303:Dsp UTSW 13 38,381,319 (GRCm39) missense probably benign
R8323:Dsp UTSW 13 38,356,806 (GRCm39) missense possibly damaging 0.80
R8326:Dsp UTSW 13 38,375,611 (GRCm39) missense probably damaging 1.00
R8358:Dsp UTSW 13 38,376,457 (GRCm39) missense possibly damaging 0.92
R8410:Dsp UTSW 13 38,380,791 (GRCm39) missense possibly damaging 0.94
R8552:Dsp UTSW 13 38,369,117 (GRCm39) missense probably damaging 0.98
R8713:Dsp UTSW 13 38,352,701 (GRCm39) missense probably damaging 0.99
R8801:Dsp UTSW 13 38,381,502 (GRCm39) missense possibly damaging 0.81
R8900:Dsp UTSW 13 38,365,155 (GRCm39) missense probably damaging 0.99
R8901:Dsp UTSW 13 38,365,155 (GRCm39) missense probably damaging 0.99
R8968:Dsp UTSW 13 38,335,596 (GRCm39) missense possibly damaging 0.83
R9014:Dsp UTSW 13 38,376,700 (GRCm39) missense possibly damaging 0.83
R9021:Dsp UTSW 13 38,380,808 (GRCm39) missense possibly damaging 0.61
R9030:Dsp UTSW 13 38,352,673 (GRCm39) missense probably damaging 1.00
R9124:Dsp UTSW 13 38,377,276 (GRCm39) missense probably benign 0.42
R9129:Dsp UTSW 13 38,377,126 (GRCm39) missense probably benign 0.09
R9143:Dsp UTSW 13 38,377,337 (GRCm39) missense probably benign 0.05
R9450:Dsp UTSW 13 38,376,379 (GRCm39) missense probably damaging 1.00
R9488:Dsp UTSW 13 38,377,218 (GRCm39) missense probably benign 0.04
R9514:Dsp UTSW 13 38,371,781 (GRCm39) missense probably benign 0.02
R9789:Dsp UTSW 13 38,367,937 (GRCm39) missense probably benign 0.03
R9792:Dsp UTSW 13 38,379,494 (GRCm39) missense possibly damaging 0.87
X0023:Dsp UTSW 13 38,381,660 (GRCm39) missense probably benign 0.00
X0024:Dsp UTSW 13 38,377,231 (GRCm39) missense probably benign 0.04
X0027:Dsp UTSW 13 38,370,622 (GRCm39) missense possibly damaging 0.68
X0067:Dsp UTSW 13 38,366,288 (GRCm39) missense possibly damaging 0.85
Z1176:Dsp UTSW 13 38,381,166 (GRCm39) missense possibly damaging 0.81
Z1177:Dsp UTSW 13 38,376,830 (GRCm39) frame shift probably null
Z1177:Dsp UTSW 13 38,335,665 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAGCCGGGAACAGTATCTC -3'
(R):5'- GGTTCAACTCCTTCTCCAGG -3'

Sequencing Primer
(F):5'- GGGAACAGTATCTCTCTCGATC -3'
(R):5'- CCCTTTTAGACAATAGAGTTTGGG -3'
Posted On 2019-10-07