Incidental Mutation 'R7477:Cdh18'
ID579579
Institutional Source Beutler Lab
Gene Symbol Cdh18
Ensembl Gene ENSMUSG00000040420
Gene Namecadherin 18
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R7477 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location22549022-23474418 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23410725 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 432 (N432S)
Ref Sequence ENSEMBL: ENSMUSP00000130851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164787] [ENSMUST00000165614] [ENSMUST00000167623] [ENSMUST00000226693]
Predicted Effect probably benign
Transcript: ENSMUST00000164787
AA Change: N432S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130851
Gene: ENSMUSG00000040420
AA Change: N432S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CA 76 157 4.24e-14 SMART
CA 181 266 1.37e-31 SMART
CA 290 382 2.76e-13 SMART
CA 405 486 3.86e-26 SMART
CA 509 596 3.7e-5 SMART
transmembrane domain 614 636 N/A INTRINSIC
Pfam:Cadherin_C 639 783 6.8e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165614
AA Change: N432S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128643
Gene: ENSMUSG00000040420
AA Change: N432S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CA 76 157 4.24e-14 SMART
CA 181 266 1.37e-31 SMART
CA 290 382 2.76e-13 SMART
CA 405 486 3.86e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167623
AA Change: N378S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000128011
Gene: ENSMUSG00000040420
AA Change: N378S

DomainStartEndE-ValueType
CA 22 103 4.24e-14 SMART
CA 127 212 1.37e-31 SMART
CA 236 328 2.76e-13 SMART
CA 351 414 4.15e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226693
AA Change: N432S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II classical cadherin from the cadherin superfamily of integral membrane proteins that mediate calcium-dependent cell-cell adhesion. Mature cadherin proteins are composed of a large N-terminal extracellular domain, a single membrane-spanning domain, and a small, highly conserved C-terminal cytoplasmic domain. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. This particular cadherin is expressed specifically in the central nervous system and is putatively involved in synaptic adhesion, axon outgrowth and guidance. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 G T 5: 35,592,103 E191* probably null Het
Adam26a T A 8: 43,569,070 E461V probably damaging Het
Adamtsl1 G A 4: 86,415,651 R1539Q probably damaging Het
Adipor2 A T 6: 119,361,922 H123Q probably benign Het
Akap13 C T 7: 75,749,247 S2691L probably benign Het
Aldh1l1 T C 6: 90,598,387 probably null Het
Ankrd11 A T 8: 122,894,385 S909R possibly damaging Het
BC049730 A G 7: 24,714,248 T230A probably benign Het
Bop1 T C 15: 76,455,326 E273G probably damaging Het
Car1 G A 3: 14,776,283 H97Y probably damaging Het
Casp14 T C 10: 78,714,304 N170S probably benign Het
Ccdc158 A T 5: 92,650,696 L382M probably damaging Het
Ccdc18 A C 5: 108,220,850 Q1279H probably damaging Het
Ctdp1 T C 18: 80,440,714 probably null Het
Dhx30 A G 9: 110,087,140 I691T probably damaging Het
Dnah9 A G 11: 65,992,731 I2562T probably damaging Het
Dsp A T 13: 38,172,863 I240F probably damaging Het
Ell T C 8: 70,585,218 S308P probably benign Het
Elmo1 A G 13: 20,285,319 D26G Het
Fam171a1 T C 2: 3,225,639 V603A probably benign Het
Fam83e G A 7: 45,728,980 G476D probably damaging Het
Farp2 A G 1: 93,581,028 probably null Het
Fcer1a C T 1: 173,221,284 probably null Het
Gpr179 G T 11: 97,335,839 T1830K possibly damaging Het
Grin3a G A 4: 49,719,278 P823S probably damaging Het
Heatr4 T A 12: 83,979,830 I218F probably damaging Het
Il1f5 T A 2: 24,279,692 Y21* probably null Het
Jakmip1 A G 5: 37,173,571 T532A probably benign Het
Klf11 A G 12: 24,653,563 D16G probably benign Het
Lrp1 T A 10: 127,568,920 I1971F probably damaging Het
Lrrc9 T A 12: 72,503,527 probably null Het
Lrrk2 C T 15: 91,812,325 L2439F probably damaging Het
Mapk14 G A 17: 28,745,078 D313N probably damaging Het
Max A T 12: 76,953,186 S52T probably benign Het
Mrpl23 A G 7: 142,537,281 R80G possibly damaging Het
Muc5ac C A 7: 141,816,282 N3186K possibly damaging Het
Mylk2 G A 2: 152,920,341 V511I probably damaging Het
Mypn T C 10: 63,125,721 M1031V possibly damaging Het
Nbeal1 A G 1: 60,261,584 T1488A probably benign Het
Ncbp1 A T 4: 46,157,897 E378D probably damaging Het
Nedd9 A T 13: 41,318,480 D174E probably benign Het
Nid2 T A 14: 19,805,973 D1255E probably benign Het
Nlrc3 A G 16: 3,964,811 C261R probably damaging Het
Olfr153 A G 2: 87,532,087 N18S probably benign Het
Pgam1 T A 19: 41,916,816 H196Q probably damaging Het
Pja2 A C 17: 64,309,645 V85G possibly damaging Het
Pkd2 G A 5: 104,483,242 V511M probably benign Het
Ppp2cb T A 8: 33,615,474 S171T probably benign Het
Prkab2 T C 3: 97,658,747 F45S probably damaging Het
Rabep2 A T 7: 126,444,818 probably null Het
Rnf41 T A 10: 128,435,434 I71N probably damaging Het
Slc5a7 G A 17: 54,281,759 P287S probably damaging Het
Smc6 A G 12: 11,271,807 D25G probably benign Het
Sptb A T 12: 76,628,565 L225Q probably damaging Het
Tenm4 A C 7: 96,845,808 I1148L probably damaging Het
Tnk2 C A 16: 32,677,891 probably null Het
Trank1 G A 9: 111,364,957 S683N probably benign Het
Trp53bp1 A C 2: 121,236,346 V633G probably benign Het
Ugt2a3 T C 5: 87,336,620 K182E possibly damaging Het
Uncx A T 5: 139,547,262 T361S probably benign Het
Vmn2r11 A T 5: 109,059,348 N35K possibly damaging Het
Vmn2r4 C A 3: 64,398,429 R524L probably benign Het
Vmn2r5 C T 3: 64,491,639 V640M probably damaging Het
Washc4 T C 10: 83,574,443 Y632H probably damaging Het
Xkr6 T C 14: 63,606,680 S51P possibly damaging Het
Zer1 C A 2: 30,107,976 K408N probably null Het
Znhit2 A G 19: 6,062,471 probably null Het
Other mutations in Cdh18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Cdh18 APN 15 23173796 missense probably damaging 0.97
IGL01663:Cdh18 APN 15 23445991 missense possibly damaging 0.92
IGL01758:Cdh18 APN 15 23474183 missense probably benign 0.20
IGL02192:Cdh18 APN 15 23460316 missense probably damaging 1.00
IGL02448:Cdh18 APN 15 23173789 missense probably benign 0.00
IGL02717:Cdh18 APN 15 23410715 nonsense probably null
IGL03241:Cdh18 APN 15 23226933 missense probably benign 0.19
IGL03268:Cdh18 APN 15 23366867 missense probably damaging 1.00
IGL03307:Cdh18 APN 15 23226786 missense probably damaging 1.00
R0316:Cdh18 UTSW 15 23366913 missense probably damaging 1.00
R0462:Cdh18 UTSW 15 23366885 missense probably damaging 1.00
R0607:Cdh18 UTSW 15 23410790 missense probably benign 0.01
R0761:Cdh18 UTSW 15 23226752 missense possibly damaging 0.87
R0973:Cdh18 UTSW 15 23473995 missense probably damaging 0.99
R1110:Cdh18 UTSW 15 23474317 missense probably benign 0.00
R1550:Cdh18 UTSW 15 23436548 missense probably damaging 1.00
R1656:Cdh18 UTSW 15 23474399 missense probably benign 0.38
R1682:Cdh18 UTSW 15 23400585 missense probably benign 0.05
R1770:Cdh18 UTSW 15 23474401 missense probably benign
R1829:Cdh18 UTSW 15 23173852 missense probably damaging 1.00
R2253:Cdh18 UTSW 15 23410805 missense probably benign 0.00
R2435:Cdh18 UTSW 15 23367008 missense probably damaging 1.00
R3914:Cdh18 UTSW 15 23410685 missense probably damaging 1.00
R3964:Cdh18 UTSW 15 23474101 missense probably benign
R4002:Cdh18 UTSW 15 23382962 missense possibly damaging 0.48
R4291:Cdh18 UTSW 15 22714551 intron probably benign
R4581:Cdh18 UTSW 15 23226783 missense probably damaging 1.00
R4604:Cdh18 UTSW 15 23474368 missense probably benign 0.05
R4625:Cdh18 UTSW 15 22714042 intron probably benign
R4786:Cdh18 UTSW 15 23410787 missense probably null 1.00
R4811:Cdh18 UTSW 15 23226791 missense probably benign 0.30
R5023:Cdh18 UTSW 15 23259666 missense probably damaging 1.00
R5094:Cdh18 UTSW 15 22714539 intron probably benign
R5278:Cdh18 UTSW 15 23474158 missense probably benign 0.04
R5416:Cdh18 UTSW 15 23226723 missense probably damaging 1.00
R5503:Cdh18 UTSW 15 23436534 missense probably damaging 0.96
R5617:Cdh18 UTSW 15 23226768 missense probably damaging 0.97
R5982:Cdh18 UTSW 15 23474216 missense possibly damaging 0.89
R6240:Cdh18 UTSW 15 23226936 missense possibly damaging 0.82
R6475:Cdh18 UTSW 15 23226936 missense possibly damaging 0.82
R6649:Cdh18 UTSW 15 23436534 missense possibly damaging 0.87
R6700:Cdh18 UTSW 15 23474105 missense probably benign
R6718:Cdh18 UTSW 15 23226749 missense probably benign 0.15
R6796:Cdh18 UTSW 15 23446073 missense probably damaging 1.00
R7330:Cdh18 UTSW 15 23226950 missense possibly damaging 0.46
R7429:Cdh18 UTSW 15 23366856 missense possibly damaging 0.89
R7516:Cdh18 UTSW 15 23259598 splice site probably null
R7519:Cdh18 UTSW 15 23474212 missense possibly damaging 0.68
R7575:Cdh18 UTSW 15 23400597 nonsense probably null
R7618:Cdh18 UTSW 15 23366970 missense probably damaging 1.00
R7844:Cdh18 UTSW 15 23410787 missense probably damaging 1.00
R7870:Cdh18 UTSW 15 23474327 missense possibly damaging 0.94
R7927:Cdh18 UTSW 15 23410787 missense probably damaging 1.00
R7953:Cdh18 UTSW 15 23474327 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGCTGCAATGTTGACTGGCTATATC -3'
(R):5'- TGCAGGACACAAATCTCTGC -3'

Sequencing Primer
(F):5'- GACTGGCTATATCAAGTTGACAGCC -3'
(R):5'- CAGAAACATTCTGTCCTGG -3'
Posted On2019-10-07