Incidental Mutation 'R0631:Fgfr2'
ID57958
Institutional Source Beutler Lab
Gene Symbol Fgfr2
Ensembl Gene ENSMUSG00000030849
Gene Namefibroblast growth factor receptor 2
SynonymsFgfr-2, KGFRTr, Bek, Fgfr7, Fgfr-7, svs
MMRRC Submission 038820-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0631 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location130162451-133123350 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to G at 130227239 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117073] [ENSMUST00000117089] [ENSMUST00000117357] [ENSMUST00000117691] [ENSMUST00000117754] [ENSMUST00000117858] [ENSMUST00000117872] [ENSMUST00000118296] [ENSMUST00000119260] [ENSMUST00000120141] [ENSMUST00000120187] [ENSMUST00000120715] [ENSMUST00000121064] [ENSMUST00000121080] [ENSMUST00000122054] [ENSMUST00000122448] [ENSMUST00000124096] [ENSMUST00000153166]
Predicted Effect probably benign
Transcript: ENSMUST00000117073
SMART Domains Protein: ENSMUSP00000112672
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 55 123 4.66e-13 SMART
IGc2 154 234 7.41e-7 SMART
transmembrane domain 260 282 N/A INTRINSIC
low complexity region 314 323 N/A INTRINSIC
TyrKc 364 640 4.38e-152 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117089
SMART Domains Protein: ENSMUSP00000112992
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 31 40 N/A INTRINSIC
IGc2 53 114 6.59e-13 SMART
low complexity region 129 146 N/A INTRINSIC
IGc2 170 238 4.66e-13 SMART
IGc2 269 347 1.9e-4 SMART
transmembrane domain 376 398 N/A INTRINSIC
low complexity region 430 439 N/A INTRINSIC
TyrKc 480 756 4.38e-152 SMART
low complexity region 784 798 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117357
SMART Domains Protein: ENSMUSP00000112580
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 55 123 4.66e-13 SMART
IGc2 154 232 1.9e-4 SMART
transmembrane domain 261 283 N/A INTRINSIC
low complexity region 315 324 N/A INTRINSIC
TyrKc 365 641 4.38e-152 SMART
low complexity region 669 683 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117691
SMART Domains Protein: ENSMUSP00000113180
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 31 40 N/A INTRINSIC
IGc2 53 114 6.59e-13 SMART
low complexity region 129 146 N/A INTRINSIC
IGc2 170 238 4.66e-13 SMART
IGc2 269 347 1.9e-4 SMART
transmembrane domain 376 398 N/A INTRINSIC
low complexity region 432 441 N/A INTRINSIC
TyrKc 482 758 4.38e-152 SMART
low complexity region 786 800 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117754
SMART Domains Protein: ENSMUSP00000113187
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 56 136 7.41e-7 SMART
transmembrane domain 162 184 N/A INTRINSIC
low complexity region 218 227 N/A INTRINSIC
TyrKc 268 544 4.38e-152 SMART
low complexity region 572 586 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117858
SMART Domains Protein: ENSMUSP00000112623
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 31 40 N/A INTRINSIC
IGc2 53 114 6.59e-13 SMART
low complexity region 129 146 N/A INTRINSIC
IGc2 170 238 4.66e-13 SMART
IGc2 269 347 1.9e-4 SMART
transmembrane domain 376 398 N/A INTRINSIC
low complexity region 432 441 N/A INTRINSIC
TyrKc 482 758 4.38e-152 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117872
SMART Domains Protein: ENSMUSP00000113994
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
IGc2 74 142 4.66e-13 SMART
IGc2 173 253 7.41e-7 SMART
transmembrane domain 279 301 N/A INTRINSIC
low complexity region 333 342 N/A INTRINSIC
TyrKc 383 659 4.38e-152 SMART
low complexity region 687 701 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118296
SMART Domains Protein: ENSMUSP00000112471
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 36 57 N/A INTRINSIC
IGc2 81 149 4.66e-13 SMART
IGc2 180 258 1.9e-4 SMART
transmembrane domain 287 309 N/A INTRINSIC
low complexity region 343 352 N/A INTRINSIC
TyrKc 393 669 4.38e-152 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119260
SMART Domains Protein: ENSMUSP00000113010
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 31 40 N/A INTRINSIC
IGc2 53 114 6.59e-13 SMART
low complexity region 129 146 N/A INTRINSIC
IGc2 170 238 4.66e-13 SMART
IGc2 269 349 7.41e-7 SMART
transmembrane domain 375 397 N/A INTRINSIC
low complexity region 429 438 N/A INTRINSIC
TyrKc 479 755 4.38e-152 SMART
low complexity region 783 797 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120141
SMART Domains Protein: ENSMUSP00000113415
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 36 57 N/A INTRINSIC
IGc2 81 149 4.66e-13 SMART
IGc2 180 258 1.9e-4 SMART
transmembrane domain 287 309 N/A INTRINSIC
low complexity region 341 350 N/A INTRINSIC
TyrKc 391 667 4.38e-152 SMART
low complexity region 695 709 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120187
SMART Domains Protein: ENSMUSP00000113248
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
IGc2 74 142 4.66e-13 SMART
IGc2 173 251 1.9e-4 SMART
transmembrane domain 280 302 N/A INTRINSIC
low complexity region 336 345 N/A INTRINSIC
TyrKc 386 662 4.38e-152 SMART
low complexity region 690 704 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120715
SMART Domains Protein: ENSMUSP00000113474
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 31 40 N/A INTRINSIC
IGc2 53 114 6.59e-13 SMART
low complexity region 129 146 N/A INTRINSIC
IGc2 170 238 4.66e-13 SMART
transmembrane domain 263 285 N/A INTRINSIC
low complexity region 319 328 N/A INTRINSIC
TyrKc 369 645 4.38e-152 SMART
low complexity region 673 687 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121064
SMART Domains Protein: ENSMUSP00000113452
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 56 134 1.9e-4 SMART
transmembrane domain 163 185 N/A INTRINSIC
low complexity region 219 228 N/A INTRINSIC
TyrKc 269 545 4.38e-152 SMART
low complexity region 573 587 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121080
SMART Domains Protein: ENSMUSP00000112585
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 55 123 4.66e-13 SMART
IGc2 154 232 1.9e-4 SMART
transmembrane domain 261 283 N/A INTRINSIC
low complexity region 317 326 N/A INTRINSIC
TyrKc 367 643 4.38e-152 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122054
SMART Domains Protein: ENSMUSP00000112430
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
low complexity region 50 59 N/A INTRINSIC
IGc2 72 133 6.59e-13 SMART
low complexity region 148 165 N/A INTRINSIC
IGc2 189 257 4.66e-13 SMART
IGc2 288 368 7.41e-7 SMART
transmembrane domain 394 416 N/A INTRINSIC
low complexity region 450 459 N/A INTRINSIC
TyrKc 500 776 4.38e-152 SMART
low complexity region 804 818 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122448
SMART Domains Protein: ENSMUSP00000113993
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 55 123 4.66e-13 SMART
IGc2 154 232 1.9e-4 SMART
transmembrane domain 261 283 N/A INTRINSIC
low complexity region 315 324 N/A INTRINSIC
TyrKc 365 641 4.38e-152 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127091
SMART Domains Protein: ENSMUSP00000122856
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:I-set 3 56 1.8e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153166
SMART Domains Protein: ENSMUSP00000120100
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
low complexity region 50 59 N/A INTRINSIC
IGc2 72 133 6.59e-13 SMART
low complexity region 148 165 N/A INTRINSIC
IGc2 189 257 4.66e-13 SMART
SCOP:d1ev2e1 269 311 1e-5 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.1%
  • 10x: 98.1%
  • 20x: 96.8%
Validation Efficiency 97% (129/133)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor receptor family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein consists of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. This particular family member is a high-affinity receptor for acidic, basic and/or keratinocyte growth factor, depending on the isoform. Mutations in this gene are associated with Crouzon syndrome, Pfeiffer syndrome, Craniosynostosis, Apert syndrome, Jackson-Weiss syndrome, Beare-Stevenson cutis gyrata syndrome, Saethre-Chotzen syndrome, and syndromic craniosynostosis. Multiple alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for null mutations die as embryos. Isoform IIIb deficient mutants die at birth with defects in multiple organs and tissues. Isoform IIIc deficient mutants have defects in osteoblast and chondrocyte lineages, producing dwarfism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 131 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833427G06Rik T A 9: 51,101,953 R6S probably benign Het
Aadat T C 8: 60,529,445 probably benign Het
Afap1l2 T C 19: 56,916,085 E594G probably benign Het
Ak8 T G 2: 28,735,665 I240S probably damaging Het
Akap13 T C 7: 75,614,996 V174A probably damaging Het
Alppl2 G A 1: 87,089,373 T66I probably damaging Het
Ankrd61 T A 5: 143,894,879 I36F probably damaging Het
Antxrl T A 14: 34,058,801 probably null Het
Arhgef2 G C 3: 88,634,436 V244L probably damaging Het
Arid1a A G 4: 133,689,170 I1098T unknown Het
Atr T C 9: 95,874,777 V903A possibly damaging Het
AW549877 A G 15: 3,986,489 probably benign Het
B3gnt6 C A 7: 98,193,692 A354S probably benign Het
Bnc1 A T 7: 81,974,366 I371N probably damaging Het
Camsap1 A T 2: 25,933,647 S1464T probably damaging Het
Cand2 G A 6: 115,803,805 E1217K probably damaging Het
Cass4 T C 2: 172,432,411 I728T probably damaging Het
Ccdc88a A T 11: 29,493,752 M1378L probably damaging Het
Ccdc9 C A 7: 16,278,459 W266L probably damaging Het
Cct6b C A 11: 82,737,088 probably null Het
Cd177 T C 7: 24,756,686 E219G probably benign Het
Cdkal1 A T 13: 29,354,684 Y497* probably null Het
Chmp2a T C 7: 13,032,444 E107G probably damaging Het
Chrna2 T G 14: 66,149,308 V301G probably benign Het
Chrna7 A G 7: 63,099,643 C364R probably benign Het
Cltc G T 11: 86,712,613 L796I probably benign Het
Col12a1 T C 9: 79,703,376 T249A probably damaging Het
Col13a1 G A 10: 61,887,350 Q270* probably null Het
Col6a1 C T 10: 76,709,735 V968M probably benign Het
Copb1 C A 7: 114,233,282 V511F probably benign Het
Daw1 C G 1: 83,197,260 S160R probably damaging Het
Ddx46 A G 13: 55,639,777 probably benign Het
Depdc7 T C 2: 104,721,987 K492E possibly damaging Het
Dmbt1 C T 7: 131,097,653 A1004V possibly damaging Het
Dnah7b G A 1: 46,240,992 V2694I probably benign Het
Dnhd1 T A 7: 105,651,624 F63I probably benign Het
Edc4 C A 8: 105,890,792 A1052E possibly damaging Het
Eif2s2 T A 2: 154,884,358 K129M probably damaging Het
Emx2 A G 19: 59,464,028 D248G probably damaging Het
Erich6b T C 14: 75,659,009 probably benign Het
Exoc3l4 A G 12: 111,427,966 K507E probably benign Het
Fanci T A 7: 79,406,205 V195E probably damaging Het
Frem1 A G 4: 82,972,165 S1007P probably damaging Het
Fry T C 5: 150,496,352 I993T possibly damaging Het
Fst A G 13: 114,454,502 S244P possibly damaging Het
Gcc1 T C 6: 28,421,010 T103A probably damaging Het
Gdf2 C T 14: 33,941,221 P24L probably damaging Het
Gja3 T C 14: 57,036,762 D51G possibly damaging Het
Gm10305 A G 4: 99,273,076 D74G unknown Het
Gm12689 G T 4: 99,296,021 G37V unknown Het
Gm5424 C T 10: 62,071,534 noncoding transcript Het
Hephl1 T C 9: 15,084,524 E434G probably benign Het
Htatip2 T C 7: 49,773,311 C205R possibly damaging Het
Igf2r T C 17: 12,717,274 probably null Het
Ints2 T C 11: 86,233,196 I589V probably benign Het
Itgae T A 11: 73,114,907 V299D probably damaging Het
Kcnma1 T C 14: 23,509,784 probably benign Het
Kif11 A G 19: 37,413,117 probably benign Het
Kif13a A G 13: 46,778,888 probably benign Het
Kif18a T A 2: 109,298,322 probably benign Het
Klhl29 T C 12: 5,094,883 T406A probably benign Het
Litaf A T 16: 10,966,412 probably benign Het
Lmntd1 T A 6: 145,430,000 I71F probably benign Het
Lrit3 A C 3: 129,788,555 C594W probably damaging Het
Lrp6 T A 6: 134,479,775 Q842L possibly damaging Het
Lrrcc1 T A 3: 14,540,119 probably benign Het
Macf1 A T 4: 123,455,524 L1829* probably null Het
Mapk1ip1 T C 7: 138,835,955 T249A possibly damaging Het
Mfap4 T C 11: 61,487,180 F173L probably damaging Het
Mfsd9 C A 1: 40,790,474 probably benign Het
Mgat4b T C 11: 50,230,763 S69P probably damaging Het
Mki67 A T 7: 135,704,388 V620D probably damaging Het
Moxd1 C T 10: 24,252,954 T201I probably damaging Het
Msh4 G C 3: 153,866,420 D774E probably benign Het
Myg1 C T 15: 102,331,849 R37C probably benign Het
Myrf C A 19: 10,228,882 A57S probably benign Het
Ndst1 G A 18: 60,700,359 probably benign Het
Nedd4l A T 18: 65,208,503 probably benign Het
Neil2 T A 14: 63,183,400 I281F possibly damaging Het
Nfatc2 T A 2: 168,590,115 D26V probably benign Het
Nt5c A G 11: 115,490,714 probably null Het
Olfr1095 T C 2: 86,850,967 T244A probably benign Het
Olfr1369-ps1 G T 13: 21,115,908 C72F probably damaging Het
Olfr202 A G 16: 59,284,207 C97R possibly damaging Het
Olfr372 T A 8: 72,058,322 I214N probably damaging Het
Olfr538 T G 7: 140,574,507 M118R probably damaging Het
Ovch2 A G 7: 107,782,021 S557P probably benign Het
Pik3cg A G 12: 32,205,203 S262P probably benign Het
Pla2g6 T A 15: 79,306,396 H322L probably damaging Het
Plch1 A T 3: 63,699,219 L1079Q probably benign Het
Plekhg4 T A 8: 105,379,302 V777D probably damaging Het
Plekhg5 A G 4: 152,112,419 D747G possibly damaging Het
Poln C A 5: 34,118,958 V318F possibly damaging Het
Pou5f2 T A 13: 78,025,754 S272T probably benign Het
Ppp1r3e T G 14: 54,876,616 S200R possibly damaging Het
Prl7d1 G A 13: 27,710,182 P135S probably benign Het
Ptgs2 G A 1: 150,104,537 V409I probably benign Het
Ptk2b T C 14: 66,177,751 T276A probably damaging Het
Ptpn3 T C 4: 57,204,921 T747A probably damaging Het
Qrfpr A G 3: 36,221,989 I84T probably damaging Het
Rab44 A G 17: 29,139,144 D102G possibly damaging Het
Rnf125 A T 18: 20,979,083 D57V possibly damaging Het
Rnf145 T C 11: 44,560,024 F392L probably damaging Het
Rttn A G 18: 88,989,546 N435S probably benign Het
Scn8a A G 15: 101,035,537 T1500A probably damaging Het
Sgsm1 A G 5: 113,285,123 probably benign Het
Sgsm3 A T 15: 81,011,736 *751C probably null Het
Slc35c2 A C 2: 165,280,929 L145R probably damaging Het
Slc4a7 A T 14: 14,757,382 E396V probably damaging Het
Smarca4 G C 9: 21,658,984 probably benign Het
Snapc3 T A 4: 83,417,802 V17D probably damaging Het
Snta1 G T 2: 154,377,072 Q448K probably benign Het
Sptbn2 A G 19: 4,739,986 D1334G probably benign Het
Stard5 A G 7: 83,632,757 R41G probably damaging Het
Stxbp5 T A 10: 9,784,358 N731I probably benign Het
Tmem135 T A 7: 89,143,788 K413* probably null Het
Tmem38a G A 8: 72,580,018 V114I probably benign Het
Tpr A G 1: 150,422,531 T1057A probably damaging Het
Ttc23l A T 15: 10,539,980 L139Q probably damaging Het
Ttn T A 2: 76,755,296 probably null Het
Tuba3b A G 6: 145,619,576 T257A probably damaging Het
Tubgcp6 A C 15: 89,100,987 Y1633D probably damaging Het
Txnl1 C T 18: 63,671,573 probably benign Het
Unc13b A G 4: 43,182,849 Q3186R possibly damaging Het
Vmn2r75 T A 7: 86,163,270 S514C probably null Het
Whrn G A 4: 63,419,489 T545I probably damaging Het
Zdhhc20 T C 14: 57,857,640 H154R probably damaging Het
Zfp462 A T 4: 55,007,563 M1L possibly damaging Het
Zfp831 A G 2: 174,645,290 K586R possibly damaging Het
Zfp990 A T 4: 145,537,302 H290L possibly damaging Het
Zfpm1 C T 8: 122,336,874 probably benign Het
Other mutations in Fgfr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Fgfr2 APN 7 130167711 missense probably benign 0.45
IGL00594:Fgfr2 APN 7 130228723 missense probably damaging 1.00
IGL00963:Fgfr2 APN 7 130228761 missense probably damaging 0.99
IGL01968:Fgfr2 APN 7 130185248 missense probably damaging 1.00
IGL02003:Fgfr2 APN 7 130219072 missense probably damaging 1.00
IGL02063:Fgfr2 APN 7 130167755 missense probably damaging 1.00
IGL02239:Fgfr2 APN 7 130177686 missense probably damaging 1.00
IGL02349:Fgfr2 APN 7 130242606 missense probably damaging 1.00
IGL02630:Fgfr2 APN 7 130228795 splice site probably null
IGL02639:Fgfr2 APN 7 130228802 splice site probably benign
IGL03058:Fgfr2 APN 7 130182692 missense probably damaging 1.00
IGL03263:Fgfr2 APN 7 130180419 missense probably benign 0.12
IGL03377:Fgfr2 APN 7 130198517 missense probably damaging 0.98
R0048:Fgfr2 UTSW 7 130180488 splice site probably benign
R0048:Fgfr2 UTSW 7 130180488 splice site probably benign
R0078:Fgfr2 UTSW 7 130201075 missense possibly damaging 0.95
R0085:Fgfr2 UTSW 7 130196263 missense probably damaging 0.99
R0278:Fgfr2 UTSW 7 130261862 unclassified probably null
R0335:Fgfr2 UTSW 7 130196249 missense probably benign 0.00
R0557:Fgfr2 UTSW 7 130219081 missense probably damaging 1.00
R0637:Fgfr2 UTSW 7 130171624 missense possibly damaging 0.89
R0841:Fgfr2 UTSW 7 130261905 missense probably benign 0.03
R0841:Fgfr2 UTSW 7 130772007 unclassified probably benign
R1646:Fgfr2 UTSW 7 130242644 missense probably damaging 1.00
R1670:Fgfr2 UTSW 7 130180457 missense probably damaging 1.00
R1678:Fgfr2 UTSW 7 130228620 splice site probably null
R1950:Fgfr2 UTSW 7 130198481 missense probably damaging 0.96
R2393:Fgfr2 UTSW 7 130227238 intron probably null
R3706:Fgfr2 UTSW 7 130198431 missense probably benign 0.31
R3717:Fgfr2 UTSW 7 130182757 missense probably damaging 1.00
R3808:Fgfr2 UTSW 7 130199848 missense probably benign 0.01
R3945:Fgfr2 UTSW 7 130177755 missense possibly damaging 0.71
R4438:Fgfr2 UTSW 7 130172930 nonsense probably null
R4718:Fgfr2 UTSW 7 130261788 missense probably damaging 1.00
R4779:Fgfr2 UTSW 7 130185193 intron probably benign
R4925:Fgfr2 UTSW 7 130185272 missense probably damaging 1.00
R4932:Fgfr2 UTSW 7 130241277 missense probably damaging 1.00
R4941:Fgfr2 UTSW 7 130198445 missense probably benign 0.21
R4980:Fgfr2 UTSW 7 130201080 missense probably damaging 1.00
R5304:Fgfr2 UTSW 7 130167774 missense probably damaging 1.00
R5313:Fgfr2 UTSW 7 130241240 missense probably benign 0.01
R5375:Fgfr2 UTSW 7 130241215 missense possibly damaging 0.65
R5652:Fgfr2 UTSW 7 130261863 missense probably damaging 1.00
R6120:Fgfr2 UTSW 7 130228690 missense probably benign 0.24
R6347:Fgfr2 UTSW 7 130261757 missense probably damaging 1.00
R6375:Fgfr2 UTSW 7 130167745 missense probably damaging 1.00
R6475:Fgfr2 UTSW 7 130201120 missense probably benign 0.03
R6481:Fgfr2 UTSW 7 130185278 missense possibly damaging 0.85
R6494:Fgfr2 UTSW 7 130198550 missense probably damaging 1.00
R6542:Fgfr2 UTSW 7 130201123 missense probably benign 0.02
R7246:Fgfr2 UTSW 7 130242406
RF016:Fgfr2 UTSW 7 130177680 missense probably benign 0.03
X0024:Fgfr2 UTSW 7 130185329 missense probably damaging 0.99
Z1088:Fgfr2 UTSW 7 130169799 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAAAGCCTGCTCAGCCAGTC -3'
(R):5'- TGGGGAAGGAACCGTTCATTTGTC -3'

Sequencing Primer
(F):5'- AAGCTCACGTAAGTTCGGC -3'
(R):5'- CATTAGGATTCACGctcatgcttc -3'
Posted On2013-07-11