Incidental Mutation 'R7477:Nlrc3'
ID579582
Institutional Source Beutler Lab
Gene Symbol Nlrc3
Ensembl Gene ENSMUSG00000049871
Gene NameNLR family, CARD domain containing 3
SynonymsCLR16.2, Caterpiller 16.2, D230007K08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R7477 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location3945007-3976632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3964811 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 261 (C261R)
Ref Sequence ENSEMBL: ENSMUSP00000137628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177551] [ENSMUST00000180200] [ENSMUST00000229884]
Predicted Effect probably damaging
Transcript: ENSMUST00000177551
AA Change: C261R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000137628
Gene: ENSMUSG00000049871
AA Change: C261R

DomainStartEndE-ValueType
Pfam:NACHT 176 342 2e-34 PFAM
LRR 702 729 3.11e-2 SMART
LRR 730 757 2.27e-4 SMART
LRR 758 785 8.15e-1 SMART
LRR 786 813 2.17e-1 SMART
LRR 814 841 2.12e-4 SMART
LRR 842 869 3.42e0 SMART
LRR 870 897 7.67e-2 SMART
LRR 898 925 3.21e0 SMART
LRR 926 953 1.67e0 SMART
LRR 954 981 4.87e-4 SMART
LRR 982 1009 4.3e0 SMART
LRR 1010 1037 3.8e-6 SMART
LRR 1038 1065 4.47e-3 SMART
LRR 1066 1093 1.08e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180200
SMART Domains Protein: ENSMUSP00000137325
Gene: ENSMUSG00000049871

DomainStartEndE-ValueType
LRR 4 24 8.65e1 SMART
LRR 25 52 2.27e-4 SMART
LRR 53 80 8.15e-1 SMART
LRR 81 108 2.17e-1 SMART
LRR 109 136 2.12e-4 SMART
LRR 137 164 3.42e0 SMART
LRR 165 192 7.67e-2 SMART
LRR 193 220 3.21e0 SMART
LRR 221 248 1.67e0 SMART
LRR 249 276 4.87e-4 SMART
LRR 277 304 4.3e0 SMART
LRR 305 332 3.8e-6 SMART
LRR 333 360 4.47e-3 SMART
LRR 361 388 1.08e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000229884
AA Change: C245R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Meta Mutation Damage Score 0.5918 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a NOD-like receptor family member. The encoded protein is a cytosolic regulator of innate immunity. This protein directly interacts with stimulator of interferon genes (STING), to prevent its proper trafficking, resulting in disruption of STING-dependent activation of the innate immune response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced susceptibility to LPS-induced toxic shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 G T 5: 35,592,103 E191* probably null Het
Adam26a T A 8: 43,569,070 E461V probably damaging Het
Adamtsl1 G A 4: 86,415,651 R1539Q probably damaging Het
Adipor2 A T 6: 119,361,922 H123Q probably benign Het
Akap13 C T 7: 75,749,247 S2691L probably benign Het
Aldh1l1 T C 6: 90,598,387 probably null Het
Ankrd11 A T 8: 122,894,385 S909R possibly damaging Het
BC049730 A G 7: 24,714,248 T230A probably benign Het
Bop1 T C 15: 76,455,326 E273G probably damaging Het
Car1 G A 3: 14,776,283 H97Y probably damaging Het
Casp14 T C 10: 78,714,304 N170S probably benign Het
Ccdc158 A T 5: 92,650,696 L382M probably damaging Het
Ccdc18 A C 5: 108,220,850 Q1279H probably damaging Het
Cdh18 A G 15: 23,410,725 N432S probably benign Het
Ctdp1 T C 18: 80,440,714 probably null Het
Dhx30 A G 9: 110,087,140 I691T probably damaging Het
Dnah9 A G 11: 65,992,731 I2562T probably damaging Het
Dsp A T 13: 38,172,863 I240F probably damaging Het
Ell T C 8: 70,585,218 S308P probably benign Het
Elmo1 A G 13: 20,285,319 D26G Het
Fam171a1 T C 2: 3,225,639 V603A probably benign Het
Fam83e G A 7: 45,728,980 G476D probably damaging Het
Farp2 A G 1: 93,581,028 probably null Het
Fcer1a C T 1: 173,221,284 probably null Het
Gpr179 G T 11: 97,335,839 T1830K possibly damaging Het
Grin3a G A 4: 49,719,278 P823S probably damaging Het
Heatr4 T A 12: 83,979,830 I218F probably damaging Het
Il1f5 T A 2: 24,279,692 Y21* probably null Het
Jakmip1 A G 5: 37,173,571 T532A probably benign Het
Klf11 A G 12: 24,653,563 D16G probably benign Het
Lrp1 T A 10: 127,568,920 I1971F probably damaging Het
Lrrc9 T A 12: 72,503,527 probably null Het
Lrrk2 C T 15: 91,812,325 L2439F probably damaging Het
Mapk14 G A 17: 28,745,078 D313N probably damaging Het
Max A T 12: 76,953,186 S52T probably benign Het
Mrpl23 A G 7: 142,537,281 R80G possibly damaging Het
Muc5ac C A 7: 141,816,282 N3186K possibly damaging Het
Mylk2 G A 2: 152,920,341 V511I probably damaging Het
Mypn T C 10: 63,125,721 M1031V possibly damaging Het
Nbeal1 A G 1: 60,261,584 T1488A probably benign Het
Ncbp1 A T 4: 46,157,897 E378D probably damaging Het
Nedd9 A T 13: 41,318,480 D174E probably benign Het
Nid2 T A 14: 19,805,973 D1255E probably benign Het
Olfr153 A G 2: 87,532,087 N18S probably benign Het
Pgam1 T A 19: 41,916,816 H196Q probably damaging Het
Pja2 A C 17: 64,309,645 V85G possibly damaging Het
Pkd2 G A 5: 104,483,242 V511M probably benign Het
Ppp2cb T A 8: 33,615,474 S171T probably benign Het
Prkab2 T C 3: 97,658,747 F45S probably damaging Het
Rabep2 A T 7: 126,444,818 probably null Het
Rnf41 T A 10: 128,435,434 I71N probably damaging Het
Slc5a7 G A 17: 54,281,759 P287S probably damaging Het
Smc6 A G 12: 11,271,807 D25G probably benign Het
Sptb A T 12: 76,628,565 L225Q probably damaging Het
Tenm4 A C 7: 96,845,808 I1148L probably damaging Het
Tnk2 C A 16: 32,677,891 probably null Het
Trank1 G A 9: 111,364,957 S683N probably benign Het
Trp53bp1 A C 2: 121,236,346 V633G probably benign Het
Ugt2a3 T C 5: 87,336,620 K182E possibly damaging Het
Uncx A T 5: 139,547,262 T361S probably benign Het
Vmn2r11 A T 5: 109,059,348 N35K possibly damaging Het
Vmn2r4 C A 3: 64,398,429 R524L probably benign Het
Vmn2r5 C T 3: 64,491,639 V640M probably damaging Het
Washc4 T C 10: 83,574,443 Y632H probably damaging Het
Xkr6 T C 14: 63,606,680 S51P possibly damaging Het
Zer1 C A 2: 30,107,976 K408N probably null Het
Znhit2 A G 19: 6,062,471 probably null Het
Other mutations in Nlrc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Nlrc3 APN 16 3955166 missense probably damaging 1.00
IGL00943:Nlrc3 APN 16 3965117 missense possibly damaging 0.94
IGL01481:Nlrc3 APN 16 3963905 missense probably damaging 1.00
IGL01517:Nlrc3 APN 16 3947487 missense probably damaging 0.99
IGL01988:Nlrc3 APN 16 3953939 missense probably benign 0.43
IGL02306:Nlrc3 APN 16 3964824 missense probably damaging 1.00
IGL02515:Nlrc3 APN 16 3949459 splice site probably benign
IGL02795:Nlrc3 APN 16 3965285 missense probably damaging 0.99
IGL02897:Nlrc3 APN 16 3964074 missense possibly damaging 0.85
IGL02992:Nlrc3 APN 16 3954023 splice site probably benign
IGL03003:Nlrc3 APN 16 3964862 missense probably benign 0.03
IGL03381:Nlrc3 APN 16 3964315 missense probably benign 0.03
R0064:Nlrc3 UTSW 16 3964087 missense possibly damaging 0.82
R0064:Nlrc3 UTSW 16 3964087 missense possibly damaging 0.82
R0122:Nlrc3 UTSW 16 3958958 missense probably damaging 0.98
R0482:Nlrc3 UTSW 16 3965192 missense possibly damaging 0.81
R0601:Nlrc3 UTSW 16 3948249 splice site probably benign
R0622:Nlrc3 UTSW 16 3953968 missense probably benign 0.04
R0675:Nlrc3 UTSW 16 3948911 missense probably benign 0.01
R1595:Nlrc3 UTSW 16 3965302 missense probably benign 0.03
R1597:Nlrc3 UTSW 16 3963995 missense probably damaging 1.00
R2013:Nlrc3 UTSW 16 3965110 missense probably damaging 1.00
R2077:Nlrc3 UTSW 16 3963992 missense probably benign 0.35
R2327:Nlrc3 UTSW 16 3953440 missense probably damaging 1.00
R2872:Nlrc3 UTSW 16 3957326 missense possibly damaging 0.56
R2872:Nlrc3 UTSW 16 3957326 missense possibly damaging 0.56
R3037:Nlrc3 UTSW 16 3952408 missense probably damaging 1.00
R3794:Nlrc3 UTSW 16 3947875 missense probably benign 0.22
R3843:Nlrc3 UTSW 16 3964964 missense probably benign
R4761:Nlrc3 UTSW 16 3963650 missense probably damaging 1.00
R5303:Nlrc3 UTSW 16 3963614 missense probably benign 0.15
R5375:Nlrc3 UTSW 16 3964753 missense possibly damaging 0.95
R5468:Nlrc3 UTSW 16 3964035 missense probably damaging 1.00
R5719:Nlrc3 UTSW 16 3963725 missense probably damaging 1.00
R5838:Nlrc3 UTSW 16 3953995 missense probably damaging 1.00
R5879:Nlrc3 UTSW 16 3964045 missense probably damaging 1.00
R5942:Nlrc3 UTSW 16 3949429 missense probably damaging 1.00
R6500:Nlrc3 UTSW 16 3952444 missense possibly damaging 0.79
R6600:Nlrc3 UTSW 16 3965074 missense probably benign 0.29
R6704:Nlrc3 UTSW 16 3965081 missense probably damaging 0.99
R7172:Nlrc3 UTSW 16 3963753 missense probably benign 0.30
R7283:Nlrc3 UTSW 16 3947877 missense probably benign 0.25
R7296:Nlrc3 UTSW 16 3963590 missense probably damaging 0.99
R7817:Nlrc3 UTSW 16 3965463 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TCTCAGTCATCCGGTCCACTAG -3'
(R):5'- ACGCTAGTGAGGCATTTTGTTC -3'

Sequencing Primer
(F):5'- TCCACTAGGCCCCCAGG -3'
(R):5'- TTCATTGCTGGGCCAGAGGAC -3'
Posted On2019-10-07