Incidental Mutation 'R7477:Mapk14'
ID579583
Institutional Source Beutler Lab
Gene Symbol Mapk14
Ensembl Gene ENSMUSG00000053436
Gene Namemitogen-activated protein kinase 14
Synonymsp38MAPK, CSBP2, p38 alpha, p38a, Mxi2, p38 MAP kinase alpha, p38 MAP Kinase, p38alpha, p38-alpha, p38, Csbp1, Crk1, p38 MAPK
MMRRC Submission
Accession Numbers

Genbank: NM_011951; MGI: 1346865

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7477 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location28691342-28748404 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 28745078 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 313 (D313N)
Ref Sequence ENSEMBL: ENSMUSP00000004990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004990] [ENSMUST00000062694] [ENSMUST00000114752] [ENSMUST00000114754] [ENSMUST00000114758]
Predicted Effect probably damaging
Transcript: ENSMUST00000004990
AA Change: D313N

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000004990
Gene: ENSMUSG00000053436
AA Change: D313N

DomainStartEndE-ValueType
S_TKc 24 308 3.46e-91 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000062694
AA Change: D313N

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000061958
Gene: ENSMUSG00000053436
AA Change: D313N

DomainStartEndE-ValueType
S_TKc 24 308 7.42e-91 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114752
AA Change: D236N

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110400
Gene: ENSMUSG00000053436
AA Change: D236N

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 193 7.3e-22 PFAM
Pfam:Pkinase 1 231 1.9e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114754
AA Change: D236N

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110402
Gene: ENSMUSG00000053436
AA Change: D236N

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 193 7.3e-22 PFAM
Pfam:Pkinase 1 231 1.9e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114758
SMART Domains Protein: ENSMUSP00000110406
Gene: ENSMUSG00000053436

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 24 242 3.8e-32 PFAM
Pfam:Pkinase 24 257 9.4e-65 PFAM
Pfam:Kdo 40 181 3e-7 PFAM
Meta Mutation Damage Score 0.4995 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase is activated by various environmental stresses and proinflammatory cytokines. The activation requires its phosphorylation by MAP kinase kinases (MKKs), or its autophosphorylation triggered by the interaction of MAP3K7IP1/TAB1 protein with this kinase. The substrates of this kinase include transcription regulator ATF2, MEF2C, and MAX, cell cycle regulator CDC25B, and tumor suppressor p53, which suggest the roles of this kinase in stress related transcription and cell cycle regulation, as well as in genotoxic stress response. Four alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for various null mutations are embryonic to perinatal lethal showing multiple organ system defects. Mice homozygous for a knock-out mutation exhibit abnormal myoblast differentiation and delayed myofiber growth and maturation. [provided by MGI curators]
Allele List at MGI

All alleles(20) : Targeted, knock-out(4) Targeted, other(9) Gene trapped(7)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 G T 5: 35,592,103 E191* probably null Het
Adam26a T A 8: 43,569,070 E461V probably damaging Het
Adamtsl1 G A 4: 86,415,651 R1539Q probably damaging Het
Adipor2 A T 6: 119,361,922 H123Q probably benign Het
Akap13 C T 7: 75,749,247 S2691L probably benign Het
Aldh1l1 T C 6: 90,598,387 probably null Het
Ankrd11 A T 8: 122,894,385 S909R possibly damaging Het
BC049730 A G 7: 24,714,248 T230A probably benign Het
Bop1 T C 15: 76,455,326 E273G probably damaging Het
Car1 G A 3: 14,776,283 H97Y probably damaging Het
Casp14 T C 10: 78,714,304 N170S probably benign Het
Ccdc158 A T 5: 92,650,696 L382M probably damaging Het
Ccdc18 A C 5: 108,220,850 Q1279H probably damaging Het
Cdh18 A G 15: 23,410,725 N432S probably benign Het
Ctdp1 T C 18: 80,440,714 probably null Het
Dhx30 A G 9: 110,087,140 I691T probably damaging Het
Dnah9 A G 11: 65,992,731 I2562T probably damaging Het
Dsp A T 13: 38,172,863 I240F probably damaging Het
Ell T C 8: 70,585,218 S308P probably benign Het
Elmo1 A G 13: 20,285,319 D26G Het
Fam171a1 T C 2: 3,225,639 V603A probably benign Het
Fam83e G A 7: 45,728,980 G476D probably damaging Het
Farp2 A G 1: 93,581,028 probably null Het
Fcer1a C T 1: 173,221,284 probably null Het
Gpr179 G T 11: 97,335,839 T1830K possibly damaging Het
Grin3a G A 4: 49,719,278 P823S probably damaging Het
Heatr4 T A 12: 83,979,830 I218F probably damaging Het
Il1f5 T A 2: 24,279,692 Y21* probably null Het
Jakmip1 A G 5: 37,173,571 T532A probably benign Het
Klf11 A G 12: 24,653,563 D16G probably benign Het
Lrp1 T A 10: 127,568,920 I1971F probably damaging Het
Lrrc9 T A 12: 72,503,527 probably null Het
Lrrk2 C T 15: 91,812,325 L2439F probably damaging Het
Max A T 12: 76,953,186 S52T probably benign Het
Mrpl23 A G 7: 142,537,281 R80G possibly damaging Het
Muc5ac C A 7: 141,816,282 N3186K possibly damaging Het
Mylk2 G A 2: 152,920,341 V511I probably damaging Het
Mypn T C 10: 63,125,721 M1031V possibly damaging Het
Nbeal1 A G 1: 60,261,584 T1488A probably benign Het
Ncbp1 A T 4: 46,157,897 E378D probably damaging Het
Nedd9 A T 13: 41,318,480 D174E probably benign Het
Nid2 T A 14: 19,805,973 D1255E probably benign Het
Nlrc3 A G 16: 3,964,811 C261R probably damaging Het
Olfr153 A G 2: 87,532,087 N18S probably benign Het
Pgam1 T A 19: 41,916,816 H196Q probably damaging Het
Pja2 A C 17: 64,309,645 V85G possibly damaging Het
Pkd2 G A 5: 104,483,242 V511M probably benign Het
Ppp2cb T A 8: 33,615,474 S171T probably benign Het
Prkab2 T C 3: 97,658,747 F45S probably damaging Het
Rabep2 A T 7: 126,444,818 probably null Het
Rnf41 T A 10: 128,435,434 I71N probably damaging Het
Slc5a7 G A 17: 54,281,759 P287S probably damaging Het
Smc6 A G 12: 11,271,807 D25G probably benign Het
Sptb A T 12: 76,628,565 L225Q probably damaging Het
Tenm4 A C 7: 96,845,808 I1148L probably damaging Het
Tnk2 C A 16: 32,677,891 probably null Het
Trank1 G A 9: 111,364,957 S683N probably benign Het
Trp53bp1 A C 2: 121,236,346 V633G probably benign Het
Ugt2a3 T C 5: 87,336,620 K182E possibly damaging Het
Uncx A T 5: 139,547,262 T361S probably benign Het
Vmn2r11 A T 5: 109,059,348 N35K possibly damaging Het
Vmn2r4 C A 3: 64,398,429 R524L probably benign Het
Vmn2r5 C T 3: 64,491,639 V640M probably damaging Het
Washc4 T C 10: 83,574,443 Y632H probably damaging Het
Xkr6 T C 14: 63,606,680 S51P possibly damaging Het
Zer1 C A 2: 30,107,976 K408N probably null Het
Znhit2 A G 19: 6,062,471 probably null Het
Other mutations in Mapk14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01680:Mapk14 APN 17 28725846 critical splice donor site probably null
IGL03013:Mapk14 APN 17 28728349 splice site probably benign
Wanzhou UTSW 17 28724824 missense probably damaging 1.00
D4043:Mapk14 UTSW 17 28745150 missense probably damaging 1.00
R0418:Mapk14 UTSW 17 28691789 missense probably benign
R4513:Mapk14 UTSW 17 28724824 missense probably damaging 1.00
R4514:Mapk14 UTSW 17 28724824 missense probably damaging 1.00
R4674:Mapk14 UTSW 17 28745022 unclassified probably null
R4981:Mapk14 UTSW 17 28741791 missense probably damaging 1.00
R5418:Mapk14 UTSW 17 28741843 missense possibly damaging 0.65
R7792:Mapk14 UTSW 17 28746297 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACACCTTAAAGGATGCTTTGTG -3'
(R):5'- AGGTCCAATCTCCAGCACTG -3'

Sequencing Primer
(F):5'- ACCTTAAAGGATGCTTTGTGTGGATG -3'
(R):5'- GCTTTTAATCTCAGCACTCGGAAGG -3'
Posted On2019-10-07