Incidental Mutation 'R7477:Slc5a7'
ID579584
Institutional Source Beutler Lab
Gene Symbol Slc5a7
Ensembl Gene ENSMUSG00000023945
Gene Namesolute carrier family 5 (choline transporter), member 7
SynonymsCHT1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7477 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location54273594-54299034 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 54281759 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 287 (P287S)
Ref Sequence ENSEMBL: ENSMUSP00000093379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095712]
Predicted Effect probably damaging
Transcript: ENSMUST00000095712
AA Change: P287S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000093379
Gene: ENSMUSG00000023945
AA Change: P287S

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:SSF 42 442 4.7e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium ion- and chloride ion-dependent high-affinity transporter that mediates choline uptake for acetylcholine synthesis in cholinergic neurons. The protein transports choline from the extracellular space into presynaptic terminals for synthesis into acetylcholine. Increased choline uptake results from increased density of this protein in synaptosomal plasma membranes in response to depolarization of cholinergic terminals. Dysfunction of cholinergic signaling has been implicated in various disorders including depression, attention-deficit disorder, and schizophrenia. An allelic variant of this gene is associated with autosomal dominant distal hereditary motor neuronopathy type VIIA. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
PHENOTYPE: Homozygous null mice display neonatal lethality with respiratory failure, hyporesponsiveness to touch, inability to sustain acetylcholine release, and abnormal neuromuscular junction morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 G T 5: 35,592,103 E191* probably null Het
Adam26a T A 8: 43,569,070 E461V probably damaging Het
Adamtsl1 G A 4: 86,415,651 R1539Q probably damaging Het
Adipor2 A T 6: 119,361,922 H123Q probably benign Het
Akap13 C T 7: 75,749,247 S2691L probably benign Het
Aldh1l1 T C 6: 90,598,387 probably null Het
Ankrd11 A T 8: 122,894,385 S909R possibly damaging Het
BC049730 A G 7: 24,714,248 T230A probably benign Het
Bop1 T C 15: 76,455,326 E273G probably damaging Het
Car1 G A 3: 14,776,283 H97Y probably damaging Het
Casp14 T C 10: 78,714,304 N170S probably benign Het
Ccdc158 A T 5: 92,650,696 L382M probably damaging Het
Ccdc18 A C 5: 108,220,850 Q1279H probably damaging Het
Cdh18 A G 15: 23,410,725 N432S probably benign Het
Ctdp1 T C 18: 80,440,714 probably null Het
Dhx30 A G 9: 110,087,140 I691T probably damaging Het
Dnah9 A G 11: 65,992,731 I2562T probably damaging Het
Dsp A T 13: 38,172,863 I240F probably damaging Het
Ell T C 8: 70,585,218 S308P probably benign Het
Elmo1 A G 13: 20,285,319 D26G Het
Fam171a1 T C 2: 3,225,639 V603A probably benign Het
Fam83e G A 7: 45,728,980 G476D probably damaging Het
Farp2 A G 1: 93,581,028 probably null Het
Fcer1a C T 1: 173,221,284 probably null Het
Gpr179 G T 11: 97,335,839 T1830K possibly damaging Het
Grin3a G A 4: 49,719,278 P823S probably damaging Het
Heatr4 T A 12: 83,979,830 I218F probably damaging Het
Il1f5 T A 2: 24,279,692 Y21* probably null Het
Jakmip1 A G 5: 37,173,571 T532A probably benign Het
Klf11 A G 12: 24,653,563 D16G probably benign Het
Lrp1 T A 10: 127,568,920 I1971F probably damaging Het
Lrrc9 T A 12: 72,503,527 probably null Het
Lrrk2 C T 15: 91,812,325 L2439F probably damaging Het
Mapk14 G A 17: 28,745,078 D313N probably damaging Het
Max A T 12: 76,953,186 S52T probably benign Het
Mrpl23 A G 7: 142,537,281 R80G possibly damaging Het
Muc5ac C A 7: 141,816,282 N3186K possibly damaging Het
Mylk2 G A 2: 152,920,341 V511I probably damaging Het
Mypn T C 10: 63,125,721 M1031V possibly damaging Het
Nbeal1 A G 1: 60,261,584 T1488A probably benign Het
Ncbp1 A T 4: 46,157,897 E378D probably damaging Het
Nedd9 A T 13: 41,318,480 D174E probably benign Het
Nid2 T A 14: 19,805,973 D1255E probably benign Het
Nlrc3 A G 16: 3,964,811 C261R probably damaging Het
Olfr153 A G 2: 87,532,087 N18S probably benign Het
Pgam1 T A 19: 41,916,816 H196Q probably damaging Het
Pja2 A C 17: 64,309,645 V85G possibly damaging Het
Pkd2 G A 5: 104,483,242 V511M probably benign Het
Ppp2cb T A 8: 33,615,474 S171T probably benign Het
Prkab2 T C 3: 97,658,747 F45S probably damaging Het
Rabep2 A T 7: 126,444,818 probably null Het
Rnf41 T A 10: 128,435,434 I71N probably damaging Het
Smc6 A G 12: 11,271,807 D25G probably benign Het
Sptb A T 12: 76,628,565 L225Q probably damaging Het
Tenm4 A C 7: 96,845,808 I1148L probably damaging Het
Tnk2 C A 16: 32,677,891 probably null Het
Trank1 G A 9: 111,364,957 S683N probably benign Het
Trp53bp1 A C 2: 121,236,346 V633G probably benign Het
Ugt2a3 T C 5: 87,336,620 K182E possibly damaging Het
Uncx A T 5: 139,547,262 T361S probably benign Het
Vmn2r11 A T 5: 109,059,348 N35K possibly damaging Het
Vmn2r4 C A 3: 64,398,429 R524L probably benign Het
Vmn2r5 C T 3: 64,491,639 V640M probably damaging Het
Washc4 T C 10: 83,574,443 Y632H probably damaging Het
Xkr6 T C 14: 63,606,680 S51P possibly damaging Het
Zer1 C A 2: 30,107,976 K408N probably null Het
Znhit2 A G 19: 6,062,471 probably null Het
Other mutations in Slc5a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Slc5a7 APN 17 54292960 missense probably benign 0.00
IGL01833:Slc5a7 APN 17 54281833 missense probably damaging 1.00
IGL02206:Slc5a7 APN 17 54296994 missense probably damaging 0.98
IGL02493:Slc5a7 APN 17 54293880 missense probably damaging 1.00
IGL02598:Slc5a7 APN 17 54284193 missense probably benign
IGL02693:Slc5a7 APN 17 54276919 missense probably benign 0.00
IGL02896:Slc5a7 APN 17 54293017 nonsense probably null
R0288:Slc5a7 UTSW 17 54293018 nonsense probably null
R1137:Slc5a7 UTSW 17 54293011 missense probably damaging 1.00
R1692:Slc5a7 UTSW 17 54281726 missense probably damaging 0.99
R1755:Slc5a7 UTSW 17 54292978 missense probably benign 0.01
R1987:Slc5a7 UTSW 17 54293835 missense probably damaging 1.00
R2373:Slc5a7 UTSW 17 54277126 missense probably damaging 1.00
R4170:Slc5a7 UTSW 17 54276858 missense probably benign 0.08
R4614:Slc5a7 UTSW 17 54276559 missense probably benign 0.00
R4785:Slc5a7 UTSW 17 54278700 missense probably damaging 1.00
R4793:Slc5a7 UTSW 17 54281794 missense possibly damaging 0.95
R4828:Slc5a7 UTSW 17 54276799 missense probably benign 0.11
R4847:Slc5a7 UTSW 17 54277140 missense possibly damaging 0.82
R4879:Slc5a7 UTSW 17 54276651 missense probably benign 0.04
R5152:Slc5a7 UTSW 17 54278833 missense possibly damaging 0.51
R5171:Slc5a7 UTSW 17 54276676 missense probably benign
R5196:Slc5a7 UTSW 17 54281722 critical splice donor site probably null
R5935:Slc5a7 UTSW 17 54276944 nonsense probably null
R6307:Slc5a7 UTSW 17 54276978 missense probably benign 0.12
R6354:Slc5a7 UTSW 17 54277033 missense probably damaging 1.00
R6357:Slc5a7 UTSW 17 54287361 missense probably benign 0.16
R6395:Slc5a7 UTSW 17 54278821 missense probably damaging 1.00
R6500:Slc5a7 UTSW 17 54284203 missense probably benign
R6643:Slc5a7 UTSW 17 54276616 missense probably benign 0.00
R7062:Slc5a7 UTSW 17 54293001 missense probably damaging 1.00
R7405:Slc5a7 UTSW 17 54297133 missense probably benign
R7470:Slc5a7 UTSW 17 54276962 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCACTAAGTGACAAATCTGGGTAGAG -3'
(R):5'- GAAGCAACACTTTCATTTGCTC -3'

Sequencing Primer
(F):5'- TGACAAATCTGGGTAGAGAACAC -3'
(R):5'- CCCTTCATTTGACTTACTCTGAATC -3'
Posted On2019-10-07