Incidental Mutation 'R7478:Man2b2'
ID579600
Institutional Source Beutler Lab
Gene Symbol Man2b2
Ensembl Gene ENSMUSG00000029119
Gene Namemannosidase 2, alpha B2
Synonyms135 kDa alpha-D-mannosidase
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7478 (G1)
Quality Score216.009
Status Validated
Chromosome5
Chromosomal Location36806921-36830653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 36810313 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 904 (H904Y)
Ref Sequence ENSEMBL: ENSMUSP00000031002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031002]
Predicted Effect probably damaging
Transcript: ENSMUST00000031002
AA Change: H904Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031002
Gene: ENSMUSG00000029119
AA Change: H904Y

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Glyco_hydro_38 28 351 4e-100 PFAM
Alpha-mann_mid 356 439 3.3e-20 SMART
Pfam:Glyco_hydro_38C 487 1013 2e-98 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000115495
Gene: ENSMUSG00000029119
AA Change: A466V

DomainStartEndE-ValueType
Pfam:Glyco_hydro_38C 67 469 2.5e-80 PFAM
low complexity region 483 493 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000114319
Gene: ENSMUSG00000029119
AA Change: H38Y

DomainStartEndE-ValueType
Pfam:Glyco_hydro_38C 2 86 4.2e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahcyl2 A G 6: 29,903,267 R516G probably damaging Het
Ak9 T C 10: 41,389,091 F948S Het
Aldh3b3 A G 19: 3,964,549 M95V probably benign Het
Ankrd34a T C 3: 96,598,500 L340P possibly damaging Het
Arid1a T A 4: 133,685,171 R1186W unknown Het
Arpc4 T A 6: 113,384,131 M95K possibly damaging Het
Atrnl1 A G 19: 57,696,312 E790G possibly damaging Het
C130074G19Rik T C 1: 184,874,427 N103D probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Camsap2 T C 1: 136,270,940 T782A Het
Catsperd A G 17: 56,664,055 I706M probably benign Het
Cbx2 T C 11: 119,029,115 V502A probably damaging Het
Cd72 T G 4: 43,454,515 I5L possibly damaging Het
Celsr3 A G 9: 108,843,578 Y2609C probably benign Het
Col19a1 C T 1: 24,317,707 G632R probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Efcc1 T C 6: 87,730,990 V33A probably damaging Het
Eif4enif1 T A 11: 3,227,709 L367* probably null Het
Eml2 T A 7: 19,206,141 L627* probably null Het
F13b A G 1: 139,507,695 T193A probably benign Het
Hif3a G A 7: 17,042,635 T462I possibly damaging Het
Ifna7 T A 4: 88,816,676 I150N probably damaging Het
Midn A G 10: 80,155,322 T389A possibly damaging Het
Myo19 A T 11: 84,885,800 H94L probably benign Het
Naglu T C 11: 101,071,899 Y177H probably damaging Het
Nek1 T A 8: 61,130,145 D1272E probably benign Het
Nxn A T 11: 76,261,552 V372E probably damaging Het
Obscn G A 11: 59,093,416 R1738C probably damaging Het
Pcm1 A G 8: 41,261,373 E266G probably benign Het
Pkd1l1 T C 11: 8,929,441 N920S Het
Pkd1l3 C A 8: 109,633,315 T944K probably damaging Het
Prl7d1 C A 13: 27,710,185 E133* probably null Het
Qser1 G A 2: 104,789,514 L228F probably damaging Het
Rasa3 A G 8: 13,614,605 I69T possibly damaging Het
Rb1 A T 14: 73,269,137 S391T probably damaging Het
Rnf220 T C 4: 117,296,136 Y301C possibly damaging Het
Sertm1 A G 3: 54,899,328 V92A possibly damaging Het
Slfn5 A G 11: 82,960,616 K580E probably damaging Het
Stard4 T C 18: 33,205,324 Y111C unknown Het
Tagap C A 17: 7,933,590 Q536K possibly damaging Het
Tank T C 2: 61,650,169 C351R probably damaging Het
Tarbp2 A T 15: 102,521,734 M144L probably benign Het
Tdrd9 T C 12: 111,985,042 Y89H probably damaging Het
Tecpr2 C A 12: 110,968,439 T1373K probably benign Het
Tle1 G A 4: 72,137,112 P434L probably damaging Het
Tmed5 A G 5: 108,124,629 V201A probably benign Het
Ust A G 10: 8,390,886 probably null Het
Vmn2r94 T C 17: 18,257,505 T215A probably benign Het
Zfp273 A T 13: 67,825,132 Q126H probably benign Het
Other mutations in Man2b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Man2b2 APN 5 36816143 nonsense probably null
IGL01098:Man2b2 APN 5 36815556 missense probably damaging 1.00
IGL01367:Man2b2 APN 5 36814337 nonsense probably null
IGL01781:Man2b2 APN 5 36813745 missense possibly damaging 0.80
IGL01809:Man2b2 APN 5 36814516 missense probably benign 0.01
IGL02824:Man2b2 APN 5 36821851 missense probably benign 0.09
IGL03323:Man2b2 APN 5 36818514 missense probably benign 0.07
IGL03333:Man2b2 APN 5 36816139 missense probably damaging 0.96
R0505:Man2b2 UTSW 5 36816198 missense probably benign 0.00
R0715:Man2b2 UTSW 5 36826058 missense probably benign 0.00
R1435:Man2b2 UTSW 5 36813067 missense probably damaging 0.98
R1536:Man2b2 UTSW 5 36820927 missense probably benign 0.10
R1944:Man2b2 UTSW 5 36816180 missense probably benign
R2079:Man2b2 UTSW 5 36814372 missense possibly damaging 0.64
R2475:Man2b2 UTSW 5 36807875 missense probably benign 0.01
R2924:Man2b2 UTSW 5 36824102 missense probably benign 0.01
R2925:Man2b2 UTSW 5 36824102 missense probably benign 0.01
R2938:Man2b2 UTSW 5 36820986 missense probably benign 0.27
R3777:Man2b2 UTSW 5 36815527 missense probably benign 0.00
R3778:Man2b2 UTSW 5 36815527 missense probably benign 0.00
R3982:Man2b2 UTSW 5 36813820 missense probably benign 0.10
R4618:Man2b2 UTSW 5 36817639 missense probably benign 0.06
R4822:Man2b2 UTSW 5 36815521 missense probably damaging 1.00
R5320:Man2b2 UTSW 5 36810333 missense probably damaging 1.00
R5394:Man2b2 UTSW 5 36814518 missense probably benign 0.03
R5468:Man2b2 UTSW 5 36807175 missense probably benign 0.00
R5993:Man2b2 UTSW 5 36820980 missense probably benign 0.12
R6053:Man2b2 UTSW 5 36813038 missense probably benign 0.00
R6083:Man2b2 UTSW 5 36809041 missense probably damaging 1.00
R6376:Man2b2 UTSW 5 36821034 missense probably damaging 1.00
R6669:Man2b2 UTSW 5 36810358 missense probably benign 0.00
R7000:Man2b2 UTSW 5 36821869 missense probably damaging 1.00
R7108:Man2b2 UTSW 5 36815485 missense probably benign 0.04
R7376:Man2b2 UTSW 5 36813378 missense probably damaging 1.00
R7712:Man2b2 UTSW 5 36810314 missense probably benign 0.00
R8059:Man2b2 UTSW 5 36816160 missense probably damaging 1.00
X0022:Man2b2 UTSW 5 36813892 missense probably damaging 0.99
Z1088:Man2b2 UTSW 5 36815356 missense possibly damaging 0.46
Z1177:Man2b2 UTSW 5 36813797 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATCCTAACACAGGGCAGC -3'
(R):5'- GATGTGTCGAGAGCAGCTTG -3'

Sequencing Primer
(F):5'- AGCCTGAGGACACTGTCTG -3'
(R):5'- GGCCTGAGGTGTGAACC -3'
Posted On2019-10-07