Incidental Mutation 'R7478:Hif3a'
ID579606
Institutional Source Beutler Lab
Gene Symbol Hif3a
Ensembl Gene ENSMUSG00000004328
Gene Namehypoxia inducible factor 3, alpha subunit
SynonymsMOP7, Nepas, bHLHe17
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.286) question?
Stock #R7478 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location17031507-17062427 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 17042635 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 462 (T462I)
Ref Sequence ENSEMBL: ENSMUSP00000104132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037762] [ENSMUST00000108492]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037762
AA Change: T460I

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000048248
Gene: ENSMUSG00000004328
AA Change: T460I

DomainStartEndE-ValueType
HLH 18 73 1.57e-7 SMART
PAS 82 148 9.83e-10 SMART
PAS 225 293 2.72e-3 SMART
PAC 299 342 2.18e-2 SMART
low complexity region 421 437 N/A INTRINSIC
Pfam:HIF-1 472 505 1.8e-18 PFAM
low complexity region 508 520 N/A INTRINSIC
low complexity region 525 536 N/A INTRINSIC
low complexity region 595 607 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108492
AA Change: T462I

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104132
Gene: ENSMUSG00000004328
AA Change: T462I

DomainStartEndE-ValueType
HLH 20 75 1.57e-7 SMART
PAS 84 150 9.83e-10 SMART
PAS 227 295 2.72e-3 SMART
PAC 301 344 2.18e-2 SMART
low complexity region 423 439 N/A INTRINSIC
Pfam:HIF-1 475 506 5.7e-18 PFAM
low complexity region 510 522 N/A INTRINSIC
low complexity region 527 538 N/A INTRINSIC
low complexity region 597 609 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the alpha-3 subunit of one of several alpha/beta-subunit heterodimeric transcription factors that regulate many adaptive responses to low oxygen tension (hypoxia). The alpha-3 subunit lacks the transactivation domain found in factors containing either the alpha-1 or alpha-2 subunits. It is thought that factors containing the alpha-3 subunit are negative regulators of hypoxia-inducible gene expression. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired lung remodeling resulting in hypertrophy of the heart right ventricle and pulmonary hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahcyl2 A G 6: 29,903,267 R516G probably damaging Het
Ak9 T C 10: 41,389,091 F948S Het
Aldh3b3 A G 19: 3,964,549 M95V probably benign Het
Ankrd34a T C 3: 96,598,500 L340P possibly damaging Het
Arid1a T A 4: 133,685,171 R1186W unknown Het
Arpc4 T A 6: 113,384,131 M95K possibly damaging Het
Atrnl1 A G 19: 57,696,312 E790G possibly damaging Het
C130074G19Rik T C 1: 184,874,427 N103D probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Camsap2 T C 1: 136,270,940 T782A Het
Catsperd A G 17: 56,664,055 I706M probably benign Het
Cbx2 T C 11: 119,029,115 V502A probably damaging Het
Cd72 T G 4: 43,454,515 I5L possibly damaging Het
Celsr3 A G 9: 108,843,578 Y2609C probably benign Het
Col19a1 C T 1: 24,317,707 G632R probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Efcc1 T C 6: 87,730,990 V33A probably damaging Het
Eif4enif1 T A 11: 3,227,709 L367* probably null Het
Eml2 T A 7: 19,206,141 L627* probably null Het
F13b A G 1: 139,507,695 T193A probably benign Het
Ifna7 T A 4: 88,816,676 I150N probably damaging Het
Man2b2 G A 5: 36,810,313 H904Y probably damaging Het
Midn A G 10: 80,155,322 T389A possibly damaging Het
Myo19 A T 11: 84,885,800 H94L probably benign Het
Naglu T C 11: 101,071,899 Y177H probably damaging Het
Nek1 T A 8: 61,130,145 D1272E probably benign Het
Nxn A T 11: 76,261,552 V372E probably damaging Het
Obscn G A 11: 59,093,416 R1738C probably damaging Het
Pcm1 A G 8: 41,261,373 E266G probably benign Het
Pkd1l1 T C 11: 8,929,441 N920S Het
Pkd1l3 C A 8: 109,633,315 T944K probably damaging Het
Prl7d1 C A 13: 27,710,185 E133* probably null Het
Qser1 G A 2: 104,789,514 L228F probably damaging Het
Rasa3 A G 8: 13,614,605 I69T possibly damaging Het
Rb1 A T 14: 73,269,137 S391T probably damaging Het
Rnf220 T C 4: 117,296,136 Y301C possibly damaging Het
Sertm1 A G 3: 54,899,328 V92A possibly damaging Het
Slfn5 A G 11: 82,960,616 K580E probably damaging Het
Stard4 T C 18: 33,205,324 Y111C unknown Het
Tagap C A 17: 7,933,590 Q536K possibly damaging Het
Tank T C 2: 61,650,169 C351R probably damaging Het
Tarbp2 A T 15: 102,521,734 M144L probably benign Het
Tdrd9 T C 12: 111,985,042 Y89H probably damaging Het
Tecpr2 C A 12: 110,968,439 T1373K probably benign Het
Tle1 G A 4: 72,137,112 P434L probably damaging Het
Tmed5 A G 5: 108,124,629 V201A probably benign Het
Ust A G 10: 8,390,886 probably null Het
Vmn2r94 T C 17: 18,257,505 T215A probably benign Het
Zfp273 A T 13: 67,825,132 Q126H probably benign Het
Other mutations in Hif3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Hif3a APN 7 17051916 splice site probably null
IGL02496:Hif3a APN 7 17039678 splice site probably benign
IGL02572:Hif3a APN 7 17050588 missense probably null
IGL02638:Hif3a APN 7 17044368 unclassified probably benign
IGL02704:Hif3a APN 7 17050761 unclassified probably benign
IGL03000:Hif3a APN 7 17048639 missense probably benign 0.08
IGL03342:Hif3a APN 7 17041122 missense possibly damaging 0.92
R0265:Hif3a UTSW 7 17035868 makesense probably null
R0326:Hif3a UTSW 7 17044400 missense probably benign 0.01
R0396:Hif3a UTSW 7 17052021 splice site probably benign
R1494:Hif3a UTSW 7 17054722 missense probably damaging 1.00
R1529:Hif3a UTSW 7 17042639 missense probably benign 0.02
R1548:Hif3a UTSW 7 17044403 missense probably benign 0.00
R1686:Hif3a UTSW 7 17044864 missense possibly damaging 0.46
R1916:Hif3a UTSW 7 17039656 missense possibly damaging 0.87
R2026:Hif3a UTSW 7 17044397 missense possibly damaging 0.81
R2032:Hif3a UTSW 7 17051179 missense probably damaging 1.00
R2354:Hif3a UTSW 7 17041105 missense probably damaging 1.00
R3693:Hif3a UTSW 7 17041074 missense probably damaging 1.00
R3780:Hif3a UTSW 7 17054713 missense probably damaging 1.00
R3921:Hif3a UTSW 7 17037172 missense possibly damaging 0.80
R4003:Hif3a UTSW 7 17044919 missense probably damaging 0.99
R4714:Hif3a UTSW 7 17056271 missense probably damaging 1.00
R4953:Hif3a UTSW 7 17050565 missense probably damaging 0.98
R5632:Hif3a UTSW 7 17050655 missense possibly damaging 0.94
R5778:Hif3a UTSW 7 17051984 missense probably damaging 1.00
R5877:Hif3a UTSW 7 17051146 missense probably damaging 1.00
R5995:Hif3a UTSW 7 17053769 missense probably benign 0.10
R6001:Hif3a UTSW 7 17050561 missense probably damaging 1.00
R6599:Hif3a UTSW 7 17042605 missense possibly damaging 0.68
R7218:Hif3a UTSW 7 17050588 missense probably damaging 1.00
R7479:Hif3a UTSW 7 17042635 missense possibly damaging 0.47
R7480:Hif3a UTSW 7 17042635 missense possibly damaging 0.47
R7482:Hif3a UTSW 7 17042635 missense possibly damaging 0.47
R7654:Hif3a UTSW 7 17049096 missense probably damaging 0.97
R7696:Hif3a UTSW 7 17054787 missense unknown
Predicted Primers PCR Primer
(F):5'- AGCCAATGAAACCATGGTCT -3'
(R):5'- CATTGCTGTTTGACCTCTTGTAA -3'

Sequencing Primer
(F):5'- CACACATATCTATCTAATCTGTCACC -3'
(R):5'- TGTAATCTTCAGCCTAAGACCC -3'
Posted On2019-10-07