Incidental Mutation 'R7478:Slfn5'
ID579621
Institutional Source Beutler Lab
Gene Symbol Slfn5
Ensembl Gene ENSMUSG00000054404
Gene Nameschlafen 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R7478 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location82951349-82964840 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82960616 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 580 (K580E)
Ref Sequence ENSEMBL: ENSMUSP00000064819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067443] [ENSMUST00000108157] [ENSMUST00000108158]
Predicted Effect probably damaging
Transcript: ENSMUST00000067443
AA Change: K580E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064819
Gene: ENSMUSG00000054404
AA Change: K580E

DomainStartEndE-ValueType
Pfam:AlbA_2 187 319 4.7e-13 PFAM
low complexity region 537 547 N/A INTRINSIC
Pfam:DUF2075 567 743 4.7e-8 PFAM
transmembrane domain 848 870 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108157
AA Change: K580E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103792
Gene: ENSMUSG00000054404
AA Change: K580E

DomainStartEndE-ValueType
Pfam:AAA_4 187 320 1.9e-15 PFAM
low complexity region 537 547 N/A INTRINSIC
Pfam:DUF2075 567 739 9.4e-9 PFAM
transmembrane domain 848 870 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108158
SMART Domains Protein: ENSMUSP00000103793
Gene: ENSMUSG00000054404

DomainStartEndE-ValueType
Pfam:AAA_4 187 320 3.4e-16 PFAM
Meta Mutation Damage Score 0.5375 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahcyl2 A G 6: 29,903,267 R516G probably damaging Het
Ak9 T C 10: 41,389,091 F948S Het
Aldh3b3 A G 19: 3,964,549 M95V probably benign Het
Ankrd34a T C 3: 96,598,500 L340P possibly damaging Het
Arid1a T A 4: 133,685,171 R1186W unknown Het
Arpc4 T A 6: 113,384,131 M95K possibly damaging Het
Atrnl1 A G 19: 57,696,312 E790G possibly damaging Het
C130074G19Rik T C 1: 184,874,427 N103D probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Camsap2 T C 1: 136,270,940 T782A Het
Catsperd A G 17: 56,664,055 I706M probably benign Het
Cbx2 T C 11: 119,029,115 V502A probably damaging Het
Cd72 T G 4: 43,454,515 I5L possibly damaging Het
Celsr3 A G 9: 108,843,578 Y2609C probably benign Het
Col19a1 C T 1: 24,317,707 G632R probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Efcc1 T C 6: 87,730,990 V33A probably damaging Het
Eif4enif1 T A 11: 3,227,709 L367* probably null Het
Eml2 T A 7: 19,206,141 L627* probably null Het
F13b A G 1: 139,507,695 T193A probably benign Het
Hif3a G A 7: 17,042,635 T462I possibly damaging Het
Ifna7 T A 4: 88,816,676 I150N probably damaging Het
Man2b2 G A 5: 36,810,313 H904Y probably damaging Het
Midn A G 10: 80,155,322 T389A possibly damaging Het
Myo19 A T 11: 84,885,800 H94L probably benign Het
Naglu T C 11: 101,071,899 Y177H probably damaging Het
Nek1 T A 8: 61,130,145 D1272E probably benign Het
Nxn A T 11: 76,261,552 V372E probably damaging Het
Obscn G A 11: 59,093,416 R1738C probably damaging Het
Pcm1 A G 8: 41,261,373 E266G probably benign Het
Pkd1l1 T C 11: 8,929,441 N920S Het
Pkd1l3 C A 8: 109,633,315 T944K probably damaging Het
Prl7d1 C A 13: 27,710,185 E133* probably null Het
Qser1 G A 2: 104,789,514 L228F probably damaging Het
Rasa3 A G 8: 13,614,605 I69T possibly damaging Het
Rb1 A T 14: 73,269,137 S391T probably damaging Het
Rnf220 T C 4: 117,296,136 Y301C possibly damaging Het
Sertm1 A G 3: 54,899,328 V92A possibly damaging Het
Stard4 T C 18: 33,205,324 Y111C unknown Het
Tagap C A 17: 7,933,590 Q536K possibly damaging Het
Tank T C 2: 61,650,169 C351R probably damaging Het
Tarbp2 A T 15: 102,521,734 M144L probably benign Het
Tdrd9 T C 12: 111,985,042 Y89H probably damaging Het
Tecpr2 C A 12: 110,968,439 T1373K probably benign Het
Tle1 G A 4: 72,137,112 P434L probably damaging Het
Tmed5 A G 5: 108,124,629 V201A probably benign Het
Ust A G 10: 8,390,886 probably null Het
Vmn2r94 T C 17: 18,257,505 T215A probably benign Het
Zfp273 A T 13: 67,825,132 Q126H probably benign Het
Other mutations in Slfn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Slfn5 APN 11 82956981 missense probably damaging 0.97
IGL01773:Slfn5 APN 11 82961331 missense probably damaging 1.00
IGL03026:Slfn5 APN 11 82956561 missense probably benign
IGL03368:Slfn5 APN 11 82956385 missense possibly damaging 0.88
R0531:Slfn5 UTSW 11 82961040 missense probably damaging 0.99
R0690:Slfn5 UTSW 11 82961403 missense probably damaging 1.00
R0939:Slfn5 UTSW 11 82961338 missense probably benign 0.04
R1005:Slfn5 UTSW 11 82960158 missense probably damaging 1.00
R1214:Slfn5 UTSW 11 82960091 missense probably benign 0.01
R1978:Slfn5 UTSW 11 82956616 missense probably benign 0.17
R4092:Slfn5 UTSW 11 82961067 missense probably damaging 1.00
R4620:Slfn5 UTSW 11 82961652 missense probably damaging 1.00
R4789:Slfn5 UTSW 11 82956400 missense probably benign 0.00
R5113:Slfn5 UTSW 11 82961696 missense probably benign 0.01
R5120:Slfn5 UTSW 11 82960928 missense probably damaging 1.00
R5262:Slfn5 UTSW 11 82956670 missense possibly damaging 0.56
R5307:Slfn5 UTSW 11 82956385 missense probably damaging 0.96
R5451:Slfn5 UTSW 11 82960086 missense probably damaging 1.00
R5498:Slfn5 UTSW 11 82957147 missense possibly damaging 0.84
R5651:Slfn5 UTSW 11 82960664 missense probably benign 0.00
R5777:Slfn5 UTSW 11 82961004 missense probably damaging 0.99
R5906:Slfn5 UTSW 11 82957276 missense probably benign 0.37
R5934:Slfn5 UTSW 11 82956592 missense probably damaging 1.00
R6521:Slfn5 UTSW 11 82960415 missense probably damaging 0.99
R6543:Slfn5 UTSW 11 82958666 splice site probably null
R6681:Slfn5 UTSW 11 82956378 missense possibly damaging 0.73
R7129:Slfn5 UTSW 11 82961150 nonsense probably null
R7309:Slfn5 UTSW 11 82956703 missense probably damaging 1.00
R7573:Slfn5 UTSW 11 82958759 missense probably damaging 1.00
R7610:Slfn5 UTSW 11 82961484 missense probably damaging 1.00
R7834:Slfn5 UTSW 11 82960452 missense possibly damaging 0.88
R7957:Slfn5 UTSW 11 82956787 missense probably benign 0.00
R8205:Slfn5 UTSW 11 82960718 missense probably benign 0.04
R8264:Slfn5 UTSW 11 82956550 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTAGAAATGCCAGTGTACCCC -3'
(R):5'- GCCACGCCCATTCAAATTGC -3'

Sequencing Primer
(F):5'- CAGGTGGAAGCTCTGTTGCAATC -3'
(R):5'- TTGCCCACCAGAAAGAAATGAATAG -3'
Posted On2019-10-07