Incidental Mutation 'R7478:Cbx2'
ID579624
Institutional Source Beutler Lab
Gene Symbol Cbx2
Ensembl Gene ENSMUSG00000025577
Gene Namechromobox 2
SynonymsM33
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7478 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location119022962-119031270 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119029115 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 502 (V502A)
Ref Sequence ENSEMBL: ENSMUSP00000026662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026662]
Predicted Effect probably damaging
Transcript: ENSMUST00000026662
AA Change: V502A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026662
Gene: ENSMUSG00000025577
AA Change: V502A

DomainStartEndE-ValueType
CHROMO 11 63 5.74e-17 SMART
AT_hook 74 86 2.05e-1 SMART
low complexity region 102 132 N/A INTRINSIC
low complexity region 197 210 N/A INTRINSIC
low complexity region 301 318 N/A INTRINSIC
low complexity region 452 465 N/A INTRINSIC
Meta Mutation Damage Score 0.4787 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: This gene encodes a component of the polycomb multiprotein complex, which is required to maintain the transcriptionally repressive state of many genes throughout development via chromatin remodeling and modification of histones. Disruption of this gene in results in male-to-female gonadal sex reversal. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutations cause malformations of the axial skeletal, reduced viability, poor growth and male to female sex reversal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahcyl2 A G 6: 29,903,267 R516G probably damaging Het
Ak9 T C 10: 41,389,091 F948S Het
Aldh3b3 A G 19: 3,964,549 M95V probably benign Het
Ankrd34a T C 3: 96,598,500 L340P possibly damaging Het
Arid1a T A 4: 133,685,171 R1186W unknown Het
Arpc4 T A 6: 113,384,131 M95K possibly damaging Het
Atrnl1 A G 19: 57,696,312 E790G possibly damaging Het
C130074G19Rik T C 1: 184,874,427 N103D probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Camsap2 T C 1: 136,270,940 T782A Het
Catsperd A G 17: 56,664,055 I706M probably benign Het
Cd72 T G 4: 43,454,515 I5L possibly damaging Het
Celsr3 A G 9: 108,843,578 Y2609C probably benign Het
Col19a1 C T 1: 24,317,707 G632R probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Efcc1 T C 6: 87,730,990 V33A probably damaging Het
Eif4enif1 T A 11: 3,227,709 L367* probably null Het
Eml2 T A 7: 19,206,141 L627* probably null Het
F13b A G 1: 139,507,695 T193A probably benign Het
Hif3a G A 7: 17,042,635 T462I possibly damaging Het
Ifna7 T A 4: 88,816,676 I150N probably damaging Het
Man2b2 G A 5: 36,810,313 H904Y probably damaging Het
Midn A G 10: 80,155,322 T389A possibly damaging Het
Myo19 A T 11: 84,885,800 H94L probably benign Het
Naglu T C 11: 101,071,899 Y177H probably damaging Het
Nek1 T A 8: 61,130,145 D1272E probably benign Het
Nxn A T 11: 76,261,552 V372E probably damaging Het
Obscn G A 11: 59,093,416 R1738C probably damaging Het
Pcm1 A G 8: 41,261,373 E266G probably benign Het
Pkd1l1 T C 11: 8,929,441 N920S Het
Pkd1l3 C A 8: 109,633,315 T944K probably damaging Het
Prl7d1 C A 13: 27,710,185 E133* probably null Het
Qser1 G A 2: 104,789,514 L228F probably damaging Het
Rasa3 A G 8: 13,614,605 I69T possibly damaging Het
Rb1 A T 14: 73,269,137 S391T probably damaging Het
Rnf220 T C 4: 117,296,136 Y301C possibly damaging Het
Sertm1 A G 3: 54,899,328 V92A possibly damaging Het
Slfn5 A G 11: 82,960,616 K580E probably damaging Het
Stard4 T C 18: 33,205,324 Y111C unknown Het
Tagap C A 17: 7,933,590 Q536K possibly damaging Het
Tank T C 2: 61,650,169 C351R probably damaging Het
Tarbp2 A T 15: 102,521,734 M144L probably benign Het
Tdrd9 T C 12: 111,985,042 Y89H probably damaging Het
Tecpr2 C A 12: 110,968,439 T1373K probably benign Het
Tle1 G A 4: 72,137,112 P434L probably damaging Het
Tmed5 A G 5: 108,124,629 V201A probably benign Het
Ust A G 10: 8,390,886 probably null Het
Vmn2r94 T C 17: 18,257,505 T215A probably benign Het
Zfp273 A T 13: 67,825,132 Q126H probably benign Het
Other mutations in Cbx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1005:Cbx2 UTSW 11 119028574 missense probably benign
R1629:Cbx2 UTSW 11 119028980 missense probably damaging 0.99
R1954:Cbx2 UTSW 11 119028340 missense probably damaging 0.99
R1962:Cbx2 UTSW 11 119028569 missense possibly damaging 0.76
R4674:Cbx2 UTSW 11 119029109 missense probably damaging 1.00
R4675:Cbx2 UTSW 11 119029109 missense probably damaging 1.00
R5558:Cbx2 UTSW 11 119028949 missense probably benign 0.01
R6446:Cbx2 UTSW 11 119027926 missense probably benign 0.08
R6550:Cbx2 UTSW 11 119029025 missense possibly damaging 0.63
R6610:Cbx2 UTSW 11 119024210 missense probably damaging 1.00
R6622:Cbx2 UTSW 11 119029135 missense probably damaging 0.99
R7095:Cbx2 UTSW 11 119028059 missense probably damaging 1.00
R7132:Cbx2 UTSW 11 119023121 missense probably benign 0.08
R8296:Cbx2 UTSW 11 119028128 missense probably damaging 1.00
R8374:Cbx2 UTSW 11 119028143 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACACCGTTAAAAGCGTCG -3'
(R):5'- CGGCTTTCCTGAGATGACAG -3'

Sequencing Primer
(F):5'- GTTAAAAGCGTCGCTGCCTC -3'
(R):5'- CAGACTGAAGTGGAGGCCC -3'
Posted On2019-10-07