Incidental Mutation 'R7478:Tdrd9'
ID579626
Institutional Source Beutler Lab
Gene Symbol Tdrd9
Ensembl Gene ENSMUSG00000054003
Gene Nametudor domain containing 9
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.297) question?
Stock #R7478 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location111971559-112068854 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111985042 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 89 (Y89H)
Ref Sequence ENSEMBL: ENSMUSP00000078022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079009] [ENSMUST00000170525] [ENSMUST00000185354] [ENSMUST00000189759] [ENSMUST00000190536]
Predicted Effect probably damaging
Transcript: ENSMUST00000079009
AA Change: Y89H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078022
Gene: ENSMUSG00000054003
AA Change: Y89H

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
DEXDc 132 327 5.64e-21 SMART
HELICc 404 502 3.22e-16 SMART
low complexity region 547 561 N/A INTRINSIC
HA2 565 666 1.9e-20 SMART
TUDOR 944 1003 1.52e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170525
SMART Domains Protein: ENSMUSP00000130014
Gene: ENSMUSG00000091402

DomainStartEndE-ValueType
Pfam:RD3 5 133 5.3e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185354
SMART Domains Protein: ENSMUSP00000140987
Gene: ENSMUSG00000091402

DomainStartEndE-ValueType
Pfam:RD3 4 100 2.9e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189759
SMART Domains Protein: ENSMUSP00000140454
Gene: ENSMUSG00000091402

DomainStartEndE-ValueType
Pfam:RD3 4 135 2.4e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190536
SMART Domains Protein: ENSMUSP00000140410
Gene: ENSMUSG00000091402

DomainStartEndE-ValueType
Pfam:RD3 4 135 2.4e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190680
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male homozygous mice are sterile, displaying small testis, arrest of male meiosis and abnormal spermatocyte morphology. Females are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahcyl2 A G 6: 29,903,267 R516G probably damaging Het
Ak9 T C 10: 41,389,091 F948S Het
Aldh3b3 A G 19: 3,964,549 M95V probably benign Het
Ankrd34a T C 3: 96,598,500 L340P possibly damaging Het
Arid1a T A 4: 133,685,171 R1186W unknown Het
Arpc4 T A 6: 113,384,131 M95K possibly damaging Het
Atrnl1 A G 19: 57,696,312 E790G possibly damaging Het
C130074G19Rik T C 1: 184,874,427 N103D probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Camsap2 T C 1: 136,270,940 T782A Het
Catsperd A G 17: 56,664,055 I706M probably benign Het
Cbx2 T C 11: 119,029,115 V502A probably damaging Het
Cd72 T G 4: 43,454,515 I5L possibly damaging Het
Celsr3 A G 9: 108,843,578 Y2609C probably benign Het
Col19a1 C T 1: 24,317,707 G632R probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Efcc1 T C 6: 87,730,990 V33A probably damaging Het
Eif4enif1 T A 11: 3,227,709 L367* probably null Het
Eml2 T A 7: 19,206,141 L627* probably null Het
F13b A G 1: 139,507,695 T193A probably benign Het
Hif3a G A 7: 17,042,635 T462I possibly damaging Het
Ifna7 T A 4: 88,816,676 I150N probably damaging Het
Man2b2 G A 5: 36,810,313 H904Y probably damaging Het
Midn A G 10: 80,155,322 T389A possibly damaging Het
Myo19 A T 11: 84,885,800 H94L probably benign Het
Naglu T C 11: 101,071,899 Y177H probably damaging Het
Nek1 T A 8: 61,130,145 D1272E probably benign Het
Nxn A T 11: 76,261,552 V372E probably damaging Het
Obscn G A 11: 59,093,416 R1738C probably damaging Het
Pcm1 A G 8: 41,261,373 E266G probably benign Het
Pkd1l1 T C 11: 8,929,441 N920S Het
Pkd1l3 C A 8: 109,633,315 T944K probably damaging Het
Prl7d1 C A 13: 27,710,185 E133* probably null Het
Qser1 G A 2: 104,789,514 L228F probably damaging Het
Rasa3 A G 8: 13,614,605 I69T possibly damaging Het
Rb1 A T 14: 73,269,137 S391T probably damaging Het
Rnf220 T C 4: 117,296,136 Y301C possibly damaging Het
Sertm1 A G 3: 54,899,328 V92A possibly damaging Het
Slfn5 A G 11: 82,960,616 K580E probably damaging Het
Stard4 T C 18: 33,205,324 Y111C unknown Het
Tagap C A 17: 7,933,590 Q536K possibly damaging Het
Tank T C 2: 61,650,169 C351R probably damaging Het
Tarbp2 A T 15: 102,521,734 M144L probably benign Het
Tecpr2 C A 12: 110,968,439 T1373K probably benign Het
Tle1 G A 4: 72,137,112 P434L probably damaging Het
Tmed5 A G 5: 108,124,629 V201A probably benign Het
Ust A G 10: 8,390,886 probably null Het
Vmn2r94 T C 17: 18,257,505 T215A probably benign Het
Zfp273 A T 13: 67,825,132 Q126H probably benign Het
Other mutations in Tdrd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Tdrd9 APN 12 112040434 missense probably damaging 1.00
IGL01373:Tdrd9 APN 12 112040434 missense probably damaging 1.00
IGL01542:Tdrd9 APN 12 112046989 missense possibly damaging 0.94
IGL02967:Tdrd9 APN 12 111992488 missense possibly damaging 0.50
IGL03063:Tdrd9 APN 12 112044299 missense probably benign 0.00
IGL03107:Tdrd9 APN 12 112042840 missense probably damaging 0.98
R0433:Tdrd9 UTSW 12 112025581 nonsense probably null
R0453:Tdrd9 UTSW 12 112068239 missense probably benign
R0655:Tdrd9 UTSW 12 112040465 missense probably damaging 1.00
R0666:Tdrd9 UTSW 12 112007580 intron probably benign
R1073:Tdrd9 UTSW 12 112023259 missense probably damaging 1.00
R1280:Tdrd9 UTSW 12 112039408 missense probably damaging 1.00
R1386:Tdrd9 UTSW 12 112044804 missense probably benign 0.21
R1521:Tdrd9 UTSW 12 112036410 missense probably damaging 1.00
R1601:Tdrd9 UTSW 12 112023253 nonsense probably null
R1651:Tdrd9 UTSW 12 112024706 missense probably damaging 0.97
R1715:Tdrd9 UTSW 12 112036439 missense possibly damaging 0.62
R1854:Tdrd9 UTSW 12 112044812 missense probably damaging 1.00
R1905:Tdrd9 UTSW 12 112063627 splice site probably benign
R2386:Tdrd9 UTSW 12 112015900 missense probably damaging 1.00
R2863:Tdrd9 UTSW 12 112031261 missense probably benign
R2915:Tdrd9 UTSW 12 112040461 missense probably damaging 1.00
R2958:Tdrd9 UTSW 12 112041672 missense probably damaging 0.97
R4033:Tdrd9 UTSW 12 111992539 missense possibly damaging 0.58
R4087:Tdrd9 UTSW 12 112013486 nonsense probably null
R4237:Tdrd9 UTSW 12 112067625 nonsense probably null
R4482:Tdrd9 UTSW 12 112014501 critical splice donor site probably null
R4501:Tdrd9 UTSW 12 112042809 missense probably benign 0.00
R4502:Tdrd9 UTSW 12 111993825 missense probably damaging 1.00
R4715:Tdrd9 UTSW 12 112041689 missense probably benign 0.00
R4803:Tdrd9 UTSW 12 111996835 nonsense probably null
R5218:Tdrd9 UTSW 12 112063475 intron probably benign
R5275:Tdrd9 UTSW 12 112051912 nonsense probably null
R5295:Tdrd9 UTSW 12 112051912 nonsense probably null
R5301:Tdrd9 UTSW 12 112036529 critical splice donor site probably null
R5339:Tdrd9 UTSW 12 112027122 missense probably damaging 1.00
R5500:Tdrd9 UTSW 12 112023268 missense probably benign 0.02
R5573:Tdrd9 UTSW 12 111997902 synonymous probably null
R5590:Tdrd9 UTSW 12 112051980 missense probably benign 0.01
R5891:Tdrd9 UTSW 12 112042719 missense probably damaging 1.00
R6056:Tdrd9 UTSW 12 111985041 missense probably damaging 1.00
R6057:Tdrd9 UTSW 12 112013286 missense possibly damaging 0.85
R6125:Tdrd9 UTSW 12 112068198 missense possibly damaging 0.89
R6254:Tdrd9 UTSW 12 112025900 splice site probably null
R6335:Tdrd9 UTSW 12 112041752 critical splice donor site probably null
R6345:Tdrd9 UTSW 12 112034608 missense probably damaging 0.99
R6792:Tdrd9 UTSW 12 112027113 missense probably benign 0.01
R6956:Tdrd9 UTSW 12 112036354 splice site probably benign
R6987:Tdrd9 UTSW 12 112025593 missense possibly damaging 0.82
R7090:Tdrd9 UTSW 12 111992470 missense probably benign
R7158:Tdrd9 UTSW 12 112036366 missense probably benign 0.08
R7220:Tdrd9 UTSW 12 112014454 missense probably damaging 1.00
R7489:Tdrd9 UTSW 12 112067637 missense probably benign 0.00
X0018:Tdrd9 UTSW 12 112039329 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- CAGTCCATCTCTATCTGGTAACTG -3'
(R):5'- CGAAGAACAGGATATTCTGGCTC -3'

Sequencing Primer
(F):5'- TGCTCAGAAACTTCGTGC -3'
(R):5'- CCCCCATTTTTAATTAAGAAGCCATG -3'
Posted On2019-10-07