Incidental Mutation 'R7479:Cr2'
ID 579639
Institutional Source Beutler Lab
Gene Symbol Cr2
Ensembl Gene ENSMUSG00000026616
Gene Name complement receptor 2
Synonyms C3DR, CD21, Cr-2, Cr1, Cr-1, CD35
MMRRC Submission 045553-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.142) question?
Stock # R7479 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 194819119-194859024 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 194840718 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000080938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082321] [ENSMUST00000193356] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000082321
SMART Domains Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
CCP 23 82 1.01e-11 SMART
CCP 91 147 9.1e-14 SMART
CCP 155 211 1.9e-16 SMART
CCP 216 272 1.6e-9 SMART
CCP 277 343 1.01e-11 SMART
CCP 352 407 1.2e-13 SMART
CCP 411 467 2.34e-16 SMART
CCP 472 523 1.24e0 SMART
CCP 528 594 4.48e-13 SMART
CCP 603 658 1.95e-13 SMART
CCP 718 778 1.75e-15 SMART
CCP 787 842 2.06e-12 SMART
CCP 850 906 7.92e-14 SMART
CCP 911 967 1.29e-13 SMART
transmembrane domain 975 997 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193356
SMART Domains Protein: ENSMUSP00000141706
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
CCP 1 46 1.2e-1 SMART
CCP 55 110 5.9e-16 SMART
CCP 114 170 1.1e-18 SMART
CCP 175 226 6.1e-3 SMART
CCP 231 297 2.2e-15 SMART
CCP 306 361 9.4e-16 SMART
CCP 421 481 8.3e-18 SMART
CCP 490 545 1e-14 SMART
CCP 553 609 4e-16 SMART
CCP 614 670 6.2e-16 SMART
transmembrane domain 678 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193801
SMART Domains Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000195120
SMART Domains Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
CCP 23 82 4.9e-14 SMART
CCP 91 147 4.5e-16 SMART
CCP 155 211 9.1e-19 SMART
CCP 216 272 8e-12 SMART
CCP 277 343 5e-14 SMART
CCP 352 407 5.9e-16 SMART
CCP 411 467 1.1e-18 SMART
CCP 472 523 6.1e-3 SMART
CCP 528 594 2.2e-15 SMART
CCP 603 658 9.4e-16 SMART
CCP 718 778 8.3e-18 SMART
CCP 787 842 1e-14 SMART
CCP 850 906 4e-16 SMART
CCP 911 967 6.2e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000210219
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,372,142 (GRCm39) M81L probably benign Het
Ano9 T C 7: 140,682,348 (GRCm39) T667A probably damaging Het
Anpep T A 7: 79,485,118 (GRCm39) I623F probably benign Het
Apba2 T C 7: 64,389,607 (GRCm39) I501T possibly damaging Het
Ascc3 T A 10: 50,525,895 (GRCm39) Y536N probably damaging Het
B4galt1 T C 4: 40,823,587 (GRCm39) Y168C probably damaging Het
C1ra G A 6: 124,494,684 (GRCm39) E316K probably benign Het
C2 A G 17: 35,082,441 (GRCm39) C647R probably damaging Het
Cnot4 G A 6: 35,001,083 (GRCm39) T604I probably benign Het
Col11a1 C T 3: 113,896,218 (GRCm39) T506I unknown Het
Ctsm A T 13: 61,685,569 (GRCm39) V281D probably damaging Het
Cyp2c69 T C 19: 39,870,001 (GRCm39) I74V probably benign Het
Dennd4c T A 4: 86,717,590 (GRCm39) V529D probably damaging Het
Dlgap3 C A 4: 127,088,418 (GRCm39) H5N possibly damaging Het
Dusp10 C A 1: 183,769,617 (GRCm39) H194Q probably damaging Het
Eln C G 5: 134,736,429 (GRCm39) G753A unknown Het
Emb T A 13: 117,385,962 (GRCm39) N118K possibly damaging Het
Fam184a C T 10: 53,531,110 (GRCm39) V755I probably benign Het
Fryl A G 5: 73,254,904 (GRCm39) I846T possibly damaging Het
Gabbr2 T A 4: 46,681,166 (GRCm39) I722F probably damaging Het
Gabrb3 T A 7: 57,474,171 (GRCm39) D362E possibly damaging Het
Galnt2 G A 8: 125,061,077 (GRCm39) G357D probably damaging Het
Gbx2 A T 1: 89,858,373 (GRCm39) S35R probably benign Het
Glg1 A G 8: 111,924,367 (GRCm39) I207T possibly damaging Het
Gm10192 A T 4: 97,071,272 (GRCm39) N44K unknown Het
Gpd1 A G 15: 99,617,984 (GRCm39) D123G probably benign Het
Grm2 A T 9: 106,531,050 (GRCm39) D146E possibly damaging Het
Gsg1l2 A G 11: 67,676,032 (GRCm39) D132G probably benign Het
Hecw1 C T 13: 14,515,425 (GRCm39) G236R probably damaging Het
Hif3a G A 7: 16,776,560 (GRCm39) T462I possibly damaging Het
Hspg2 C T 4: 137,266,714 (GRCm39) A1934V probably benign Het
Il7r C T 15: 9,513,117 (GRCm39) A131T probably damaging Het
Itga6 C T 2: 71,668,680 (GRCm39) R540* probably null Het
Kcnh2 A G 5: 24,530,490 (GRCm39) probably null Het
Kcnq4 C T 4: 120,573,022 (GRCm39) A260T probably damaging Het
Lrp1b T C 2: 40,691,517 (GRCm39) N3434S Het
Lrrc41 C T 4: 115,946,238 (GRCm39) P318S probably damaging Het
Map4 G A 9: 109,897,892 (GRCm39) G873R possibly damaging Het
Med24 A G 11: 98,595,787 (GRCm39) I968T possibly damaging Het
Mfap5 T C 6: 122,503,821 (GRCm39) probably null Het
Mtcl1 A G 17: 66,686,485 (GRCm39) V807A probably benign Het
Mug1 T A 6: 121,855,467 (GRCm39) S934T possibly damaging Het
Nckap5l C A 15: 99,321,127 (GRCm39) V1218F probably damaging Het
Nek1 T A 8: 61,583,179 (GRCm39) D1272E probably benign Het
Nkx2-4 T C 2: 146,926,088 (GRCm39) E258G probably benign Het
Polr1a T A 6: 71,913,281 (GRCm39) V545E probably damaging Het
Ppp1r9b A G 11: 94,882,858 (GRCm39) D162G possibly damaging Het
Rhot2 A G 17: 26,059,723 (GRCm39) L367P probably damaging Het
Ripk2 A G 4: 16,155,154 (GRCm39) F122L probably benign Het
Scn11a T C 9: 119,588,941 (GRCm39) T1322A probably benign Het
Scn8a T A 15: 100,853,358 (GRCm39) L115Q probably damaging Het
Sel1l3 G T 5: 53,274,462 (GRCm39) P1006Q probably damaging Het
Septin11 A T 5: 93,304,804 (GRCm39) N207I probably damaging Het
Sez6l2 C T 7: 126,562,831 (GRCm39) T669I probably damaging Het
Sfxn4 T A 19: 60,847,112 (GRCm39) D57V possibly damaging Het
Smarca2 T A 19: 26,617,887 (GRCm39) V306D probably benign Het
Srgap3 C T 6: 112,712,794 (GRCm39) probably null Het
Tas2r134 T C 2: 51,517,541 (GRCm39) F7L not run Het
Tbcd T C 11: 121,383,431 (GRCm39) probably null Het
Tcn2 G A 11: 3,867,703 (GRCm39) A413V probably damaging Het
Tdp1 T C 12: 99,857,654 (GRCm39) V71A probably benign Het
Tjp1 T C 7: 64,950,928 (GRCm39) T1649A probably damaging Het
Tnc T C 4: 63,935,865 (GRCm39) E357G possibly damaging Het
Tnrc6b A G 15: 80,773,327 (GRCm39) T1158A probably benign Het
Ttn C A 2: 76,568,952 (GRCm39) E27314* probably null Het
Vps35 G T 8: 85,997,434 (GRCm39) T512K probably benign Het
Zfp40 A T 17: 23,396,292 (GRCm39) S98R probably benign Het
Zfp764l1 C T 7: 126,992,496 (GRCm39) C38Y probably null Het
Zfp945 A T 17: 23,070,340 (GRCm39) C541S possibly damaging Het
Zfp976 T A 7: 42,262,603 (GRCm39) E412D probably benign Het
Other mutations in Cr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Cr2 APN 1 194,836,559 (GRCm39) missense possibly damaging 0.76
IGL01326:Cr2 APN 1 194,823,529 (GRCm39) missense probably null 1.00
IGL01358:Cr2 APN 1 194,842,128 (GRCm39) missense probably damaging 1.00
IGL01410:Cr2 APN 1 194,845,542 (GRCm39) missense possibly damaging 0.49
IGL01468:Cr2 APN 1 194,850,843 (GRCm39) missense probably damaging 1.00
IGL01608:Cr2 APN 1 194,837,528 (GRCm39) missense possibly damaging 0.50
IGL01810:Cr2 APN 1 194,841,903 (GRCm39) missense possibly damaging 0.49
IGL01843:Cr2 APN 1 194,833,222 (GRCm39) splice site probably benign
IGL02332:Cr2 APN 1 194,842,630 (GRCm39) missense probably benign 0.19
IGL02934:Cr2 APN 1 194,836,633 (GRCm39) splice site probably benign
IGL02938:Cr2 APN 1 194,848,696 (GRCm39) missense probably damaging 1.00
IGL03149:Cr2 APN 1 194,848,674 (GRCm39) missense probably damaging 1.00
IGL03327:Cr2 APN 1 194,852,067 (GRCm39) missense probably damaging 1.00
IGL03346:Cr2 APN 1 194,852,067 (GRCm39) missense probably damaging 1.00
Pillar UTSW 1 194,838,196 (GRCm39) nonsense probably null
PIT4354001:Cr2 UTSW 1 194,848,617 (GRCm39) missense probably damaging 1.00
PIT4418001:Cr2 UTSW 1 194,839,760 (GRCm39) missense probably benign 0.08
R0128:Cr2 UTSW 1 194,848,539 (GRCm39) missense probably damaging 0.99
R0130:Cr2 UTSW 1 194,848,539 (GRCm39) missense probably damaging 0.99
R0380:Cr2 UTSW 1 194,839,715 (GRCm39) missense probably damaging 1.00
R0538:Cr2 UTSW 1 194,842,667 (GRCm39) splice site probably benign
R0605:Cr2 UTSW 1 194,845,904 (GRCm39) splice site probably benign
R0626:Cr2 UTSW 1 194,853,419 (GRCm39) missense possibly damaging 0.95
R1135:Cr2 UTSW 1 194,839,498 (GRCm39) missense probably damaging 1.00
R1396:Cr2 UTSW 1 194,851,561 (GRCm39) splice site probably null
R1422:Cr2 UTSW 1 194,853,433 (GRCm39) missense probably benign 0.01
R1467:Cr2 UTSW 1 194,839,817 (GRCm39) missense probably damaging 1.00
R1467:Cr2 UTSW 1 194,839,817 (GRCm39) missense probably damaging 1.00
R1511:Cr2 UTSW 1 194,837,580 (GRCm39) missense possibly damaging 0.92
R1572:Cr2 UTSW 1 194,845,622 (GRCm39) missense probably damaging 1.00
R1714:Cr2 UTSW 1 194,833,994 (GRCm39) missense possibly damaging 0.46
R1748:Cr2 UTSW 1 194,838,213 (GRCm39) nonsense probably null
R1761:Cr2 UTSW 1 194,837,431 (GRCm39) critical splice donor site probably null
R1824:Cr2 UTSW 1 194,839,624 (GRCm39) missense probably damaging 1.00
R1893:Cr2 UTSW 1 194,837,495 (GRCm39) missense probably benign 0.03
R1990:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R1991:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R1992:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R2191:Cr2 UTSW 1 194,845,689 (GRCm39) missense possibly damaging 0.94
R2276:Cr2 UTSW 1 194,839,676 (GRCm39) missense possibly damaging 0.94
R2277:Cr2 UTSW 1 194,839,676 (GRCm39) missense possibly damaging 0.94
R3548:Cr2 UTSW 1 194,838,196 (GRCm39) nonsense probably null
R3743:Cr2 UTSW 1 194,832,274 (GRCm39) splice site probably benign
R3941:Cr2 UTSW 1 194,848,122 (GRCm39) missense probably damaging 0.97
R3963:Cr2 UTSW 1 194,842,047 (GRCm39) missense probably damaging 1.00
R4211:Cr2 UTSW 1 194,838,636 (GRCm39) missense probably damaging 0.96
R4484:Cr2 UTSW 1 194,836,482 (GRCm39) missense probably damaging 1.00
R4546:Cr2 UTSW 1 194,853,349 (GRCm39) missense possibly damaging 0.94
R4791:Cr2 UTSW 1 194,838,243 (GRCm39) missense probably damaging 1.00
R4801:Cr2 UTSW 1 194,845,619 (GRCm39) missense probably damaging 1.00
R4802:Cr2 UTSW 1 194,845,619 (GRCm39) missense probably damaging 1.00
R4874:Cr2 UTSW 1 194,858,878 (GRCm39) missense possibly damaging 0.82
R4885:Cr2 UTSW 1 194,841,039 (GRCm39) missense possibly damaging 0.92
R4889:Cr2 UTSW 1 194,858,893 (GRCm39) missense possibly damaging 0.70
R5154:Cr2 UTSW 1 194,841,754 (GRCm39) missense probably damaging 1.00
R5574:Cr2 UTSW 1 194,823,544 (GRCm39) missense probably damaging 1.00
R5594:Cr2 UTSW 1 194,839,498 (GRCm39) missense probably damaging 1.00
R5645:Cr2 UTSW 1 194,836,581 (GRCm39) missense probably damaging 1.00
R5700:Cr2 UTSW 1 194,842,065 (GRCm39) missense probably damaging 0.96
R5929:Cr2 UTSW 1 194,853,419 (GRCm39) missense possibly damaging 0.91
R6237:Cr2 UTSW 1 194,839,810 (GRCm39) missense probably damaging 1.00
R6299:Cr2 UTSW 1 194,850,954 (GRCm39) missense probably damaging 1.00
R6368:Cr2 UTSW 1 194,850,780 (GRCm39) missense probably damaging 1.00
R6406:Cr2 UTSW 1 194,852,079 (GRCm39) missense probably damaging 1.00
R6618:Cr2 UTSW 1 194,839,687 (GRCm39) missense probably damaging 0.98
R6684:Cr2 UTSW 1 194,853,329 (GRCm39) nonsense probably null
R6720:Cr2 UTSW 1 194,837,508 (GRCm39) missense probably damaging 0.97
R6866:Cr2 UTSW 1 194,833,999 (GRCm39) missense probably damaging 1.00
R6915:Cr2 UTSW 1 194,853,454 (GRCm39) missense probably benign 0.06
R7057:Cr2 UTSW 1 194,833,918 (GRCm39) missense possibly damaging 0.83
R7117:Cr2 UTSW 1 194,842,909 (GRCm39) missense possibly damaging 0.79
R7200:Cr2 UTSW 1 194,845,557 (GRCm39) missense probably damaging 1.00
R7209:Cr2 UTSW 1 194,851,032 (GRCm39) missense probably damaging 1.00
R7350:Cr2 UTSW 1 194,837,594 (GRCm39) missense probably benign 0.21
R7414:Cr2 UTSW 1 194,832,344 (GRCm39) missense probably benign
R7453:Cr2 UTSW 1 194,847,565 (GRCm39) splice site probably null
R7480:Cr2 UTSW 1 194,836,484 (GRCm39) missense probably damaging 1.00
R7570:Cr2 UTSW 1 194,851,648 (GRCm39) nonsense probably null
R7666:Cr2 UTSW 1 194,836,533 (GRCm39) missense probably damaging 1.00
R7921:Cr2 UTSW 1 194,833,975 (GRCm39) missense possibly damaging 0.94
R7923:Cr2 UTSW 1 194,850,995 (GRCm39) missense probably benign 0.03
R8396:Cr2 UTSW 1 194,840,376 (GRCm39) missense probably damaging 1.00
R8503:Cr2 UTSW 1 194,845,850 (GRCm39) missense probably benign
R8517:Cr2 UTSW 1 194,838,207 (GRCm39) missense probably benign 0.03
R8773:Cr2 UTSW 1 194,840,913 (GRCm39) missense probably damaging 1.00
R8849:Cr2 UTSW 1 194,839,547 (GRCm39) missense probably damaging 1.00
R8896:Cr2 UTSW 1 194,851,581 (GRCm39) missense possibly damaging 0.58
R8938:Cr2 UTSW 1 194,853,424 (GRCm39) missense probably damaging 0.99
R9027:Cr2 UTSW 1 194,834,029 (GRCm39) missense probably benign 0.08
R9045:Cr2 UTSW 1 194,837,680 (GRCm39) missense possibly damaging 0.61
R9116:Cr2 UTSW 1 194,840,977 (GRCm39) nonsense probably null
R9137:Cr2 UTSW 1 194,850,640 (GRCm39) critical splice donor site probably null
R9476:Cr2 UTSW 1 194,840,416 (GRCm39) missense probably damaging 0.97
R9497:Cr2 UTSW 1 194,850,743 (GRCm39) missense probably damaging 0.99
R9510:Cr2 UTSW 1 194,840,416 (GRCm39) missense probably damaging 0.97
R9752:Cr2 UTSW 1 194,823,575 (GRCm39) missense probably benign 0.37
R9799:Cr2 UTSW 1 194,842,988 (GRCm39) missense probably benign 0.02
X0028:Cr2 UTSW 1 194,832,290 (GRCm39) missense probably benign 0.09
X0066:Cr2 UTSW 1 194,848,629 (GRCm39) missense probably damaging 0.99
Z1176:Cr2 UTSW 1 194,836,461 (GRCm39) missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TGGGATCTAGAGGCAGACTAAC -3'
(R):5'- ATTACTCCCCAGTGCACAGGTAC -3'

Sequencing Primer
(F):5'- CTAGAGGCAGACTAACAAATTTTAGG -3'
(R):5'- CCCAGTGCACAGGTACTATGATG -3'
Posted On 2019-10-07