Incidental Mutation 'R7479:Gabbr2'
ID579649
Institutional Source Beutler Lab
Gene Symbol Gabbr2
Ensembl Gene ENSMUSG00000039809
Gene Namegamma-aminobutyric acid (GABA) B receptor, 2
SynonymsGpr51, Gababr2, LOC242425
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock #R7479 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location46662305-46991873 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 46681166 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 722 (I722F)
Ref Sequence ENSEMBL: ENSMUSP00000103378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107749] [ENSMUST00000205643]
Predicted Effect probably damaging
Transcript: ENSMUST00000107749
AA Change: I722F

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103378
Gene: ENSMUSG00000039809
AA Change: I722F

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:Peripla_BP_6 59 434 1.5e-15 PFAM
Pfam:ANF_receptor 75 429 2e-51 PFAM
Pfam:7tm_3 492 745 6.4e-57 PFAM
PDB:4PAS|B 778 818 1e-18 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000205643
AA Change: I132F

PolyPhen 2 Score 0.683 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The multi-pass membrane protein encoded by this gene belongs to the G-protein coupled receptor 3 family and GABA-B receptor subfamily. The GABA-B receptors inhibit neuronal activity through G protein-coupled second-messenger systems, which regulate the release of neurotransmitters, and the activity of ion channels and adenylyl cyclase. This receptor subunit forms an active heterodimeric complex with GABA-B receptor subunit 1, neither of which is effective on its own. Allelic variants of this gene have been associated with nicotine dependence.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous mutation of this gene results in clonic seizures, hyperactivity, hyperalgesia in response to thermal or mechanical stimuli, increased anxiety, and decreased depression-related behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,578,493 M81L probably benign Het
Ano9 T C 7: 141,102,435 T667A probably damaging Het
Anpep T A 7: 79,835,370 I623F probably benign Het
Apba2 T C 7: 64,739,859 I501T possibly damaging Het
Ascc3 T A 10: 50,649,799 Y536N probably damaging Het
B4galt1 T C 4: 40,823,587 Y168C probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C2 A G 17: 34,863,465 C647R probably damaging Het
Cnot4 G A 6: 35,024,148 T604I probably benign Het
Col11a1 C T 3: 114,102,569 T506I unknown Het
Cr2 A C 1: 195,158,410 probably null Het
Ctsm A T 13: 61,537,755 V281D probably damaging Het
Cyp2c69 T C 19: 39,881,557 I74V probably benign Het
Dennd4c T A 4: 86,799,353 V529D probably damaging Het
Dlgap3 C A 4: 127,194,625 H5N possibly damaging Het
Dusp10 C A 1: 184,037,420 H194Q probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eln C G 5: 134,707,575 G753A unknown Het
Emb T A 13: 117,249,426 N118K possibly damaging Het
Fam184a C T 10: 53,655,014 V755I probably benign Het
Fryl A G 5: 73,097,561 I846T possibly damaging Het
Gabrb3 T A 7: 57,824,423 D362E possibly damaging Het
Galnt2 G A 8: 124,334,338 G357D probably damaging Het
Gbx2 A T 1: 89,930,651 S35R probably benign Het
Glg1 A G 8: 111,197,735 I207T possibly damaging Het
Gm10192 A T 4: 97,183,035 N44K unknown Het
Gpd1 A G 15: 99,720,103 D123G probably benign Het
Grm2 A T 9: 106,653,851 D146E possibly damaging Het
Gsg1l2 A G 11: 67,785,206 D132G probably benign Het
Hecw1 C T 13: 14,340,840 G236R probably damaging Het
Hif3a G A 7: 17,042,635 T462I possibly damaging Het
Hspg2 C T 4: 137,539,403 A1934V probably benign Het
Il7r C T 15: 9,513,031 A131T probably damaging Het
Itga6 C T 2: 71,838,336 R540* probably null Het
Kcnh2 A G 5: 24,325,492 probably null Het
Kcnq4 C T 4: 120,715,825 A260T probably damaging Het
Lrp1b T C 2: 40,801,505 N3434S Het
Lrrc41 C T 4: 116,089,041 P318S probably damaging Het
Map4 G A 9: 110,068,824 G873R possibly damaging Het
Med24 A G 11: 98,704,961 I968T possibly damaging Het
Mfap5 T C 6: 122,526,862 probably null Het
Mtcl1 A G 17: 66,379,490 V807A probably benign Het
Mug1 T A 6: 121,878,508 S934T possibly damaging Het
Nckap5l C A 15: 99,423,246 V1218F probably damaging Het
Nek1 T A 8: 61,130,145 D1272E probably benign Het
Nkx2-4 T C 2: 147,084,168 E258G probably benign Het
Polr1a T A 6: 71,936,297 V545E probably damaging Het
Ppp1r9b A G 11: 94,992,032 D162G possibly damaging Het
Rhot2 A G 17: 25,840,749 L367P probably damaging Het
Ripk2 A G 4: 16,155,154 F122L probably benign Het
Scn11a T C 9: 119,759,875 T1322A probably benign Het
Scn8a T A 15: 100,955,477 L115Q probably damaging Het
Sel1l3 G T 5: 53,117,120 P1006Q probably damaging Het
Sept11 A T 5: 93,156,945 N207I probably damaging Het
Sez6l2 C T 7: 126,963,659 T669I probably damaging Het
Sfxn4 T A 19: 60,858,674 D57V possibly damaging Het
Smarca2 T A 19: 26,640,487 V306D probably benign Het
Srgap3 C T 6: 112,735,833 probably null Het
Tas2r134 T C 2: 51,627,529 F7L not run Het
Tbcd T C 11: 121,492,605 probably null Het
Tcn2 G A 11: 3,917,703 A413V probably damaging Het
Tdp1 T C 12: 99,891,395 V71A probably benign Het
Tjp1 T C 7: 65,301,180 T1649A probably damaging Het
Tnc T C 4: 64,017,628 E357G possibly damaging Het
Tnrc6b A G 15: 80,889,126 T1158A probably benign Het
Ttn C A 2: 76,738,608 E27314* probably null Het
Vps35 G T 8: 85,270,805 T512K probably benign Het
Zfp40 A T 17: 23,177,318 S98R probably benign Het
Zfp945 A T 17: 22,851,366 C541S possibly damaging Het
Zfp976 T A 7: 42,613,179 E412D probably benign Het
Other mutations in Gabbr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Gabbr2 APN 4 46787600 missense probably damaging 1.00
IGL00844:Gabbr2 APN 4 46875711 missense probably damaging 1.00
IGL01584:Gabbr2 APN 4 46674524 missense probably damaging 0.97
IGL01684:Gabbr2 APN 4 46736501 missense probably benign
IGL01884:Gabbr2 APN 4 46875711 missense probably damaging 1.00
IGL02073:Gabbr2 APN 4 46667547 missense probably benign 0.00
IGL02376:Gabbr2 APN 4 46684300 missense probably damaging 1.00
R0194:Gabbr2 UTSW 4 46787565 missense possibly damaging 0.48
R0627:Gabbr2 UTSW 4 46681223 missense possibly damaging 0.92
R0685:Gabbr2 UTSW 4 46787521 missense possibly damaging 0.64
R0781:Gabbr2 UTSW 4 46718838 missense probably damaging 1.00
R0882:Gabbr2 UTSW 4 46718904 missense probably damaging 1.00
R0883:Gabbr2 UTSW 4 46677474 missense probably benign 0.00
R1004:Gabbr2 UTSW 4 46677544 missense possibly damaging 0.60
R1078:Gabbr2 UTSW 4 46664833 missense probably damaging 0.99
R1110:Gabbr2 UTSW 4 46718838 missense probably damaging 1.00
R1368:Gabbr2 UTSW 4 46674464 missense probably benign 0.31
R1557:Gabbr2 UTSW 4 46846436 missense probably damaging 1.00
R1577:Gabbr2 UTSW 4 46684319 missense probably benign 0.29
R1645:Gabbr2 UTSW 4 46664963 splice site probably null
R1743:Gabbr2 UTSW 4 46677603 missense possibly damaging 0.47
R1848:Gabbr2 UTSW 4 46739823 missense probably benign 0.31
R1997:Gabbr2 UTSW 4 46787502 missense probably damaging 1.00
R2009:Gabbr2 UTSW 4 46734119 missense probably damaging 1.00
R4021:Gabbr2 UTSW 4 46846435 missense probably damaging 1.00
R4719:Gabbr2 UTSW 4 46718797 missense probably damaging 0.99
R4757:Gabbr2 UTSW 4 46875675 missense probably damaging 0.98
R4798:Gabbr2 UTSW 4 46991139 missense possibly damaging 0.92
R5086:Gabbr2 UTSW 4 46724342 missense probably damaging 1.00
R5176:Gabbr2 UTSW 4 46681208 missense probably damaging 0.99
R5451:Gabbr2 UTSW 4 46684294 missense probably benign 0.15
R5510:Gabbr2 UTSW 4 46734113 missense probably damaging 1.00
R5611:Gabbr2 UTSW 4 46804105 missense probably damaging 0.98
R6049:Gabbr2 UTSW 4 46787641 missense probably damaging 1.00
R6089:Gabbr2 UTSW 4 46846448 missense probably damaging 1.00
R6118:Gabbr2 UTSW 4 46736459 missense probably damaging 1.00
R6209:Gabbr2 UTSW 4 46804069 missense probably damaging 1.00
R6212:Gabbr2 UTSW 4 46681189 missense probably damaging 0.98
R6717:Gabbr2 UTSW 4 46787574 missense possibly damaging 0.50
R7339:Gabbr2 UTSW 4 46846340 missense probably benign 0.01
R7695:Gabbr2 UTSW 4 46875687 missense probably damaging 1.00
R7808:Gabbr2 UTSW 4 46875744 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- GTAGGTATACACAAATGCACTTGC -3'
(R):5'- AGACGTTCCTGCAGCTTACC -3'

Sequencing Primer
(F):5'- GCACATGCATGCACACAC -3'
(R):5'- TTACCCAGCAGTGAAGACCGG -3'
Posted On2019-10-07