Incidental Mutation 'R7479:Kcnq4'
ID579654
Institutional Source Beutler Lab
Gene Symbol Kcnq4
Ensembl Gene ENSMUSG00000028631
Gene Namepotassium voltage-gated channel, subfamily Q, member 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.465) question?
Stock #R7479 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location120696138-120748612 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 120715825 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 260 (A260T)
Ref Sequence ENSEMBL: ENSMUSP00000030376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030376]
Predicted Effect probably damaging
Transcript: ENSMUST00000030376
AA Change: A260T

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030376
Gene: ENSMUSG00000028631
AA Change: A260T

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
low complexity region 36 77 N/A INTRINSIC
Pfam:Ion_trans 99 331 1.2e-28 PFAM
Pfam:Ion_trans_2 244 324 5.4e-16 PFAM
Pfam:KCNQ_channel 465 655 1.6e-93 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a potassium channel that is thought to play a critical role in the regulation of neuronal excitability, particularly in sensory cells of the cochlea. The current generated by this channel is inhibited by M1 muscarinic acetylcholine receptors and activated by retigabine, a novel anti-convulsant drug. The encoded protein can form a homomultimeric potassium channel or possibly a heteromultimeric channel in association with the protein encoded by the KCNQ3 gene. Defects in this gene are a cause of nonsyndromic sensorineural deafness type 2 (DFNA2), an autosomal dominant form of progressive hearing loss. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that are either homozygous for a knock-out allele or homozygous for a dominant negative knock-in allele exhibit a slowly progressive hearing loss due to chronic depolarization and subsequent degeneration of cochlear outer hair cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,578,493 M81L probably benign Het
Ano9 T C 7: 141,102,435 T667A probably damaging Het
Anpep T A 7: 79,835,370 I623F probably benign Het
Apba2 T C 7: 64,739,859 I501T possibly damaging Het
Ascc3 T A 10: 50,649,799 Y536N probably damaging Het
B4galt1 T C 4: 40,823,587 Y168C probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C2 A G 17: 34,863,465 C647R probably damaging Het
Cnot4 G A 6: 35,024,148 T604I probably benign Het
Col11a1 C T 3: 114,102,569 T506I unknown Het
Cr2 A C 1: 195,158,410 probably null Het
Ctsm A T 13: 61,537,755 V281D probably damaging Het
Cyp2c69 T C 19: 39,881,557 I74V probably benign Het
Dennd4c T A 4: 86,799,353 V529D probably damaging Het
Dlgap3 C A 4: 127,194,625 H5N possibly damaging Het
Dusp10 C A 1: 184,037,420 H194Q probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eln C G 5: 134,707,575 G753A unknown Het
Emb T A 13: 117,249,426 N118K possibly damaging Het
Fam184a C T 10: 53,655,014 V755I probably benign Het
Fryl A G 5: 73,097,561 I846T possibly damaging Het
Gabbr2 T A 4: 46,681,166 I722F probably damaging Het
Gabrb3 T A 7: 57,824,423 D362E possibly damaging Het
Galnt2 G A 8: 124,334,338 G357D probably damaging Het
Gbx2 A T 1: 89,930,651 S35R probably benign Het
Glg1 A G 8: 111,197,735 I207T possibly damaging Het
Gm10192 A T 4: 97,183,035 N44K unknown Het
Gpd1 A G 15: 99,720,103 D123G probably benign Het
Grm2 A T 9: 106,653,851 D146E possibly damaging Het
Gsg1l2 A G 11: 67,785,206 D132G probably benign Het
Hecw1 C T 13: 14,340,840 G236R probably damaging Het
Hif3a G A 7: 17,042,635 T462I possibly damaging Het
Hspg2 C T 4: 137,539,403 A1934V probably benign Het
Il7r C T 15: 9,513,031 A131T probably damaging Het
Itga6 C T 2: 71,838,336 R540* probably null Het
Kcnh2 A G 5: 24,325,492 probably null Het
Lrp1b T C 2: 40,801,505 N3434S Het
Lrrc41 C T 4: 116,089,041 P318S probably damaging Het
Map4 G A 9: 110,068,824 G873R possibly damaging Het
Med24 A G 11: 98,704,961 I968T possibly damaging Het
Mfap5 T C 6: 122,526,862 probably null Het
Mtcl1 A G 17: 66,379,490 V807A probably benign Het
Mug1 T A 6: 121,878,508 S934T possibly damaging Het
Nckap5l C A 15: 99,423,246 V1218F probably damaging Het
Nek1 T A 8: 61,130,145 D1272E probably benign Het
Nkx2-4 T C 2: 147,084,168 E258G probably benign Het
Polr1a T A 6: 71,936,297 V545E probably damaging Het
Ppp1r9b A G 11: 94,992,032 D162G possibly damaging Het
Rhot2 A G 17: 25,840,749 L367P probably damaging Het
Ripk2 A G 4: 16,155,154 F122L probably benign Het
Scn11a T C 9: 119,759,875 T1322A probably benign Het
Scn8a T A 15: 100,955,477 L115Q probably damaging Het
Sel1l3 G T 5: 53,117,120 P1006Q probably damaging Het
Sept11 A T 5: 93,156,945 N207I probably damaging Het
Sez6l2 C T 7: 126,963,659 T669I probably damaging Het
Sfxn4 T A 19: 60,858,674 D57V possibly damaging Het
Smarca2 T A 19: 26,640,487 V306D probably benign Het
Srgap3 C T 6: 112,735,833 probably null Het
Tas2r134 T C 2: 51,627,529 F7L not run Het
Tbcd T C 11: 121,492,605 probably null Het
Tcn2 G A 11: 3,917,703 A413V probably damaging Het
Tdp1 T C 12: 99,891,395 V71A probably benign Het
Tjp1 T C 7: 65,301,180 T1649A probably damaging Het
Tnc T C 4: 64,017,628 E357G possibly damaging Het
Tnrc6b A G 15: 80,889,126 T1158A probably benign Het
Ttn C A 2: 76,738,608 E27314* probably null Het
Vps35 G T 8: 85,270,805 T512K probably benign Het
Zfp40 A T 17: 23,177,318 S98R probably benign Het
Zfp945 A T 17: 22,851,366 C541S possibly damaging Het
Zfp976 T A 7: 42,613,179 E412D probably benign Het
Other mutations in Kcnq4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Kcnq4 APN 4 120698016 nonsense probably null
IGL00225:Kcnq4 APN 4 120698016 nonsense probably null
IGL00228:Kcnq4 APN 4 120698016 nonsense probably null
IGL00310:Kcnq4 APN 4 120698016 nonsense probably null
IGL00330:Kcnq4 APN 4 120698016 nonsense probably null
IGL00333:Kcnq4 APN 4 120698016 nonsense probably null
IGL00335:Kcnq4 APN 4 120698016 nonsense probably null
IGL00336:Kcnq4 APN 4 120698016 nonsense probably null
IGL01143:Kcnq4 APN 4 120698623 missense probably damaging 1.00
IGL01373:Kcnq4 APN 4 120717032 missense probably damaging 1.00
IGL02095:Kcnq4 APN 4 120700027 splice site probably benign
IGL02335:Kcnq4 APN 4 120715854 missense probably damaging 1.00
IGL03188:Kcnq4 APN 4 120704426 missense possibly damaging 0.81
R0045:Kcnq4 UTSW 4 120697955 missense probably damaging 0.99
R0045:Kcnq4 UTSW 4 120697955 missense probably damaging 0.99
R0423:Kcnq4 UTSW 4 120717508 missense probably damaging 1.00
R0483:Kcnq4 UTSW 4 120716601 missense probably damaging 1.00
R0837:Kcnq4 UTSW 4 120746861 missense probably benign 0.00
R1722:Kcnq4 UTSW 4 120702427 missense probably benign 0.00
R1826:Kcnq4 UTSW 4 120704504 missense probably benign 0.00
R2059:Kcnq4 UTSW 4 120698002 missense probably benign 0.00
R4327:Kcnq4 UTSW 4 120711364 missense probably benign 0.00
R4690:Kcnq4 UTSW 4 120717011 missense probably damaging 0.99
R4706:Kcnq4 UTSW 4 120704486 missense probably benign
R4729:Kcnq4 UTSW 4 120713074 missense possibly damaging 0.47
R4806:Kcnq4 UTSW 4 120713094 missense probably damaging 1.00
R4859:Kcnq4 UTSW 4 120716613 missense probably damaging 1.00
R4885:Kcnq4 UTSW 4 120713063 missense probably benign 0.01
R5073:Kcnq4 UTSW 4 120717517 missense probably damaging 1.00
R5517:Kcnq4 UTSW 4 120715809 missense possibly damaging 0.66
R5590:Kcnq4 UTSW 4 120715885 missense probably damaging 0.98
R5653:Kcnq4 UTSW 4 120702411 missense probably benign 0.00
R5750:Kcnq4 UTSW 4 120715049 missense probably damaging 1.00
R6141:Kcnq4 UTSW 4 120715869 missense probably damaging 1.00
R6160:Kcnq4 UTSW 4 120716559 missense probably damaging 1.00
R7087:Kcnq4 UTSW 4 120704399 missense probably damaging 0.96
R7088:Kcnq4 UTSW 4 120704399 missense probably damaging 0.96
R7143:Kcnq4 UTSW 4 120711239 missense probably benign 0.05
R7225:Kcnq4 UTSW 4 120746914 missense probably benign 0.03
R7574:Kcnq4 UTSW 4 120711368 missense probably benign
R7879:Kcnq4 UTSW 4 120702435 missense probably benign 0.13
R7962:Kcnq4 UTSW 4 120702435 missense probably benign 0.13
X0020:Kcnq4 UTSW 4 120715327 missense probably damaging 1.00
Z1176:Kcnq4 UTSW 4 120698497 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CACAGCCTTAGTGTGAAGAGAC -3'
(R):5'- TGCCATGATTAAGGGCAGGC -3'

Sequencing Primer
(F):5'- CCTTAGTGTGAAGAGACAAGGAC -3'
(R):5'- ATTAAGGGCAGGCCTGGGC -3'
Posted On2019-10-07