Incidental Mutation 'R7479:Sept11'
ID579660
Institutional Source Beutler Lab
Gene Symbol Sept11
Ensembl Gene ENSMUSG00000058013
Gene Nameseptin 11
Synonyms6230410I01Rik, D5Ertd606e
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.331) question?
Stock #R7479 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location93093437-93176447 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93156945 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 207 (N207I)
Ref Sequence ENSEMBL: ENSMUSP00000074293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074733] [ENSMUST00000201421] [ENSMUST00000201700] [ENSMUST00000202196] [ENSMUST00000202217] [ENSMUST00000202308]
Predicted Effect probably damaging
Transcript: ENSMUST00000074733
AA Change: N207I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000074293
Gene: ENSMUSG00000058013
AA Change: N207I

DomainStartEndE-ValueType
Pfam:Septin 38 311 5.3e-101 PFAM
Pfam:MMR_HSR1 43 185 3.8e-8 PFAM
low complexity region 350 366 N/A INTRINSIC
low complexity region 376 391 N/A INTRINSIC
low complexity region 396 419 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201421
AA Change: N207I

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143928
Gene: ENSMUSG00000058013
AA Change: N207I

DomainStartEndE-ValueType
Pfam:Septin 38 311 5.3e-101 PFAM
Pfam:MMR_HSR1 43 185 3.8e-8 PFAM
low complexity region 350 366 N/A INTRINSIC
low complexity region 376 391 N/A INTRINSIC
low complexity region 396 419 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201700
AA Change: N207I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143901
Gene: ENSMUSG00000058013
AA Change: N207I

DomainStartEndE-ValueType
Pfam:Septin 38 311 7.9e-99 PFAM
Pfam:MMR_HSR1 43 185 7e-7 PFAM
coiled coil region 333 409 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202196
AA Change: N150I

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144573
Gene: ENSMUSG00000058013
AA Change: N150I

DomainStartEndE-ValueType
Pfam:Septin 1 204 5.9e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000202217
AA Change: N207I

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144235
Gene: ENSMUSG00000058013
AA Change: N207I

DomainStartEndE-ValueType
Pfam:Septin 38 311 7.7e-101 PFAM
Pfam:MMR_HSR1 43 185 4.1e-8 PFAM
low complexity region 350 366 N/A INTRINSIC
low complexity region 376 391 N/A INTRINSIC
low complexity region 396 419 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202308
AA Change: N207I

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144136
Gene: ENSMUSG00000058013
AA Change: N207I

DomainStartEndE-ValueType
Pfam:Septin 38 311 5.1e-101 PFAM
Pfam:MMR_HSR1 43 185 3.7e-8 PFAM
low complexity region 350 366 N/A INTRINSIC
low complexity region 376 391 N/A INTRINSIC
low complexity region 396 419 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SEPT11 belongs to the conserved septin family of filament-forming cytoskeletal GTPases that are involved in a variety of cellular functions including cytokinesis and vesicle trafficking (Hanai et al., 2004 [PubMed 15196925]; Nagata et al., 2004 [PubMed 15485874]).[supplied by OMIM, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,578,493 M81L probably benign Het
Ano9 T C 7: 141,102,435 T667A probably damaging Het
Anpep T A 7: 79,835,370 I623F probably benign Het
Apba2 T C 7: 64,739,859 I501T possibly damaging Het
Ascc3 T A 10: 50,649,799 Y536N probably damaging Het
B4galt1 T C 4: 40,823,587 Y168C probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C2 A G 17: 34,863,465 C647R probably damaging Het
Cnot4 G A 6: 35,024,148 T604I probably benign Het
Col11a1 C T 3: 114,102,569 T506I unknown Het
Cr2 A C 1: 195,158,410 probably null Het
Ctsm A T 13: 61,537,755 V281D probably damaging Het
Cyp2c69 T C 19: 39,881,557 I74V probably benign Het
Dennd4c T A 4: 86,799,353 V529D probably damaging Het
Dlgap3 C A 4: 127,194,625 H5N possibly damaging Het
Dusp10 C A 1: 184,037,420 H194Q probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eln C G 5: 134,707,575 G753A unknown Het
Emb T A 13: 117,249,426 N118K possibly damaging Het
Fam184a C T 10: 53,655,014 V755I probably benign Het
Fryl A G 5: 73,097,561 I846T possibly damaging Het
Gabbr2 T A 4: 46,681,166 I722F probably damaging Het
Gabrb3 T A 7: 57,824,423 D362E possibly damaging Het
Galnt2 G A 8: 124,334,338 G357D probably damaging Het
Gbx2 A T 1: 89,930,651 S35R probably benign Het
Glg1 A G 8: 111,197,735 I207T possibly damaging Het
Gm10192 A T 4: 97,183,035 N44K unknown Het
Gpd1 A G 15: 99,720,103 D123G probably benign Het
Grm2 A T 9: 106,653,851 D146E possibly damaging Het
Gsg1l2 A G 11: 67,785,206 D132G probably benign Het
Hecw1 C T 13: 14,340,840 G236R probably damaging Het
Hif3a G A 7: 17,042,635 T462I possibly damaging Het
Hspg2 C T 4: 137,539,403 A1934V probably benign Het
Il7r C T 15: 9,513,031 A131T probably damaging Het
Itga6 C T 2: 71,838,336 R540* probably null Het
Kcnh2 A G 5: 24,325,492 probably null Het
Kcnq4 C T 4: 120,715,825 A260T probably damaging Het
Lrp1b T C 2: 40,801,505 N3434S Het
Lrrc41 C T 4: 116,089,041 P318S probably damaging Het
Map4 G A 9: 110,068,824 G873R possibly damaging Het
Med24 A G 11: 98,704,961 I968T possibly damaging Het
Mfap5 T C 6: 122,526,862 probably null Het
Mtcl1 A G 17: 66,379,490 V807A probably benign Het
Mug1 T A 6: 121,878,508 S934T possibly damaging Het
Nckap5l C A 15: 99,423,246 V1218F probably damaging Het
Nek1 T A 8: 61,130,145 D1272E probably benign Het
Nkx2-4 T C 2: 147,084,168 E258G probably benign Het
Polr1a T A 6: 71,936,297 V545E probably damaging Het
Ppp1r9b A G 11: 94,992,032 D162G possibly damaging Het
Rhot2 A G 17: 25,840,749 L367P probably damaging Het
Ripk2 A G 4: 16,155,154 F122L probably benign Het
Scn11a T C 9: 119,759,875 T1322A probably benign Het
Scn8a T A 15: 100,955,477 L115Q probably damaging Het
Sel1l3 G T 5: 53,117,120 P1006Q probably damaging Het
Sez6l2 C T 7: 126,963,659 T669I probably damaging Het
Sfxn4 T A 19: 60,858,674 D57V possibly damaging Het
Smarca2 T A 19: 26,640,487 V306D probably benign Het
Srgap3 C T 6: 112,735,833 probably null Het
Tas2r134 T C 2: 51,627,529 F7L not run Het
Tbcd T C 11: 121,492,605 probably null Het
Tcn2 G A 11: 3,917,703 A413V probably damaging Het
Tdp1 T C 12: 99,891,395 V71A probably benign Het
Tjp1 T C 7: 65,301,180 T1649A probably damaging Het
Tnc T C 4: 64,017,628 E357G possibly damaging Het
Tnrc6b A G 15: 80,889,126 T1158A probably benign Het
Ttn C A 2: 76,738,608 E27314* probably null Het
Vps35 G T 8: 85,270,805 T512K probably benign Het
Zfp40 A T 17: 23,177,318 S98R probably benign Het
Zfp945 A T 17: 22,851,366 C541S possibly damaging Het
Zfp976 T A 7: 42,613,179 E412D probably benign Het
Other mutations in Sept11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Sept11 APN 5 93157018 splice site probably null
IGL00984:Sept11 APN 5 93162184 missense possibly damaging 0.90
IGL01452:Sept11 APN 5 93161204 missense possibly damaging 0.82
IGL01677:Sept11 APN 5 93148533 missense probably damaging 0.98
IGL01732:Sept11 APN 5 93161226 missense probably damaging 1.00
IGL02476:Sept11 APN 5 93148584 critical splice donor site probably null
I0000:Sept11 UTSW 5 93165259 missense probably benign 0.05
R0544:Sept11 UTSW 5 93165368 missense possibly damaging 0.80
R0611:Sept11 UTSW 5 93167534 missense probably damaging 0.99
R1438:Sept11 UTSW 5 93148428 missense probably damaging 1.00
R1702:Sept11 UTSW 5 93156924 missense probably damaging 1.00
R1727:Sept11 UTSW 5 93156924 missense probably damaging 1.00
R3838:Sept11 UTSW 5 93148399 missense probably damaging 1.00
R3847:Sept11 UTSW 5 93162167 missense probably damaging 1.00
R4609:Sept11 UTSW 5 93162254 missense possibly damaging 0.89
R4717:Sept11 UTSW 5 93156956 missense possibly damaging 0.89
R4852:Sept11 UTSW 5 93162253 missense possibly damaging 0.52
R4986:Sept11 UTSW 5 93161241 missense probably damaging 1.00
R5806:Sept11 UTSW 5 93167578 missense probably benign 0.18
R5826:Sept11 UTSW 5 93139450 missense possibly damaging 0.79
R5896:Sept11 UTSW 5 93156965 missense probably damaging 1.00
R6641:Sept11 UTSW 5 93139552 missense probably damaging 1.00
R7144:Sept11 UTSW 5 93156866 missense probably benign 0.00
R7757:Sept11 UTSW 5 93171464 splice site probably null
R8056:Sept11 UTSW 5 93167576 missense unknown
R8103:Sept11 UTSW 5 93161148 critical splice acceptor site probably null
Z1177:Sept11 UTSW 5 93156963 missense probably damaging 0.96
Z1177:Sept11 UTSW 5 93162283 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTGCCTGCACCTTACAATGG -3'
(R):5'- TTAGGTGACTGGAAGTCCCACTG -3'

Sequencing Primer
(F):5'- CACCTTACAATGGTGCCTTGTGG -3'
(R):5'- AAGTCCCACTGAGGACCTCTG -3'
Posted On2019-10-07