Incidental Mutation 'R7479:Zfp976'
ID579669
Institutional Source Beutler Lab
Gene Symbol Zfp976
Ensembl Gene ENSMUSG00000074158
Gene Namezinc finger protein 976
Synonyms9830147E19Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R7479 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location42609526-42642588 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 42613179 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 412 (E412D)
Ref Sequence ENSEMBL: ENSMUSP00000096105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098503] [ENSMUST00000187616]
Predicted Effect probably benign
Transcript: ENSMUST00000098503
AA Change: E412D

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000096105
Gene: ENSMUSG00000074158
AA Change: E412D

DomainStartEndE-ValueType
KRAB 4 66 1.73e-18 SMART
ZnF_C2H2 131 153 7.78e-3 SMART
ZnF_C2H2 159 181 1.67e-2 SMART
ZnF_C2H2 187 209 5.9e-3 SMART
ZnF_C2H2 215 237 1.38e-3 SMART
ZnF_C2H2 243 265 8.94e-3 SMART
ZnF_C2H2 271 293 2.24e-3 SMART
ZnF_C2H2 299 321 1.03e-2 SMART
ZnF_C2H2 327 349 1.58e-3 SMART
ZnF_C2H2 355 377 7.9e-4 SMART
ZnF_C2H2 383 405 5.9e-3 SMART
ZnF_C2H2 411 433 2.57e-3 SMART
ZnF_C2H2 439 461 3.16e-3 SMART
ZnF_C2H2 467 489 1.26e-2 SMART
ZnF_C2H2 495 517 8.34e-3 SMART
ZnF_C2H2 523 545 3.63e-3 SMART
ZnF_C2H2 551 573 4.79e-3 SMART
ZnF_C2H2 579 601 9.73e-4 SMART
ZnF_C2H2 607 629 3.63e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187616
AA Change: E411D

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000141023
Gene: ENSMUSG00000074158
AA Change: E411D

DomainStartEndE-ValueType
KRAB 3 65 7.4e-21 SMART
ZnF_C2H2 130 152 3.2e-5 SMART
ZnF_C2H2 158 180 7.1e-5 SMART
ZnF_C2H2 186 208 2.4e-5 SMART
ZnF_C2H2 214 236 5.7e-6 SMART
ZnF_C2H2 242 264 3.8e-5 SMART
ZnF_C2H2 270 292 9.7e-6 SMART
ZnF_C2H2 298 320 4.2e-5 SMART
ZnF_C2H2 326 348 6.6e-6 SMART
ZnF_C2H2 354 376 3.3e-6 SMART
ZnF_C2H2 382 404 2.5e-5 SMART
ZnF_C2H2 410 432 1e-5 SMART
ZnF_C2H2 438 460 1.3e-5 SMART
ZnF_C2H2 466 488 5.2e-5 SMART
ZnF_C2H2 494 516 3.6e-5 SMART
ZnF_C2H2 522 544 1.6e-5 SMART
ZnF_C2H2 550 572 2e-5 SMART
ZnF_C2H2 578 600 4e-6 SMART
ZnF_C2H2 606 628 1.5e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,578,493 M81L probably benign Het
Ano9 T C 7: 141,102,435 T667A probably damaging Het
Anpep T A 7: 79,835,370 I623F probably benign Het
Apba2 T C 7: 64,739,859 I501T possibly damaging Het
Ascc3 T A 10: 50,649,799 Y536N probably damaging Het
B4galt1 T C 4: 40,823,587 Y168C probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C2 A G 17: 34,863,465 C647R probably damaging Het
Cnot4 G A 6: 35,024,148 T604I probably benign Het
Col11a1 C T 3: 114,102,569 T506I unknown Het
Cr2 A C 1: 195,158,410 probably null Het
Ctsm A T 13: 61,537,755 V281D probably damaging Het
Cyp2c69 T C 19: 39,881,557 I74V probably benign Het
Dennd4c T A 4: 86,799,353 V529D probably damaging Het
Dlgap3 C A 4: 127,194,625 H5N possibly damaging Het
Dusp10 C A 1: 184,037,420 H194Q probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eln C G 5: 134,707,575 G753A unknown Het
Emb T A 13: 117,249,426 N118K possibly damaging Het
Fam184a C T 10: 53,655,014 V755I probably benign Het
Fryl A G 5: 73,097,561 I846T possibly damaging Het
Gabbr2 T A 4: 46,681,166 I722F probably damaging Het
Gabrb3 T A 7: 57,824,423 D362E possibly damaging Het
Galnt2 G A 8: 124,334,338 G357D probably damaging Het
Gbx2 A T 1: 89,930,651 S35R probably benign Het
Glg1 A G 8: 111,197,735 I207T possibly damaging Het
Gm10192 A T 4: 97,183,035 N44K unknown Het
Gpd1 A G 15: 99,720,103 D123G probably benign Het
Grm2 A T 9: 106,653,851 D146E possibly damaging Het
Gsg1l2 A G 11: 67,785,206 D132G probably benign Het
Hecw1 C T 13: 14,340,840 G236R probably damaging Het
Hif3a G A 7: 17,042,635 T462I possibly damaging Het
Hspg2 C T 4: 137,539,403 A1934V probably benign Het
Il7r C T 15: 9,513,031 A131T probably damaging Het
Itga6 C T 2: 71,838,336 R540* probably null Het
Kcnh2 A G 5: 24,325,492 probably null Het
Kcnq4 C T 4: 120,715,825 A260T probably damaging Het
Lrp1b T C 2: 40,801,505 N3434S Het
Lrrc41 C T 4: 116,089,041 P318S probably damaging Het
Map4 G A 9: 110,068,824 G873R possibly damaging Het
Med24 A G 11: 98,704,961 I968T possibly damaging Het
Mfap5 T C 6: 122,526,862 probably null Het
Mtcl1 A G 17: 66,379,490 V807A probably benign Het
Mug1 T A 6: 121,878,508 S934T possibly damaging Het
Nckap5l C A 15: 99,423,246 V1218F probably damaging Het
Nek1 T A 8: 61,130,145 D1272E probably benign Het
Nkx2-4 T C 2: 147,084,168 E258G probably benign Het
Polr1a T A 6: 71,936,297 V545E probably damaging Het
Ppp1r9b A G 11: 94,992,032 D162G possibly damaging Het
Rhot2 A G 17: 25,840,749 L367P probably damaging Het
Ripk2 A G 4: 16,155,154 F122L probably benign Het
Scn11a T C 9: 119,759,875 T1322A probably benign Het
Scn8a T A 15: 100,955,477 L115Q probably damaging Het
Sel1l3 G T 5: 53,117,120 P1006Q probably damaging Het
Sept11 A T 5: 93,156,945 N207I probably damaging Het
Sez6l2 C T 7: 126,963,659 T669I probably damaging Het
Sfxn4 T A 19: 60,858,674 D57V possibly damaging Het
Smarca2 T A 19: 26,640,487 V306D probably benign Het
Srgap3 C T 6: 112,735,833 probably null Het
Tas2r134 T C 2: 51,627,529 F7L not run Het
Tbcd T C 11: 121,492,605 probably null Het
Tcn2 G A 11: 3,917,703 A413V probably damaging Het
Tdp1 T C 12: 99,891,395 V71A probably benign Het
Tjp1 T C 7: 65,301,180 T1649A probably damaging Het
Tnc T C 4: 64,017,628 E357G possibly damaging Het
Tnrc6b A G 15: 80,889,126 T1158A probably benign Het
Ttn C A 2: 76,738,608 E27314* probably null Het
Vps35 G T 8: 85,270,805 T512K probably benign Het
Zfp40 A T 17: 23,177,318 S98R probably benign Het
Zfp945 A T 17: 22,851,366 C541S possibly damaging Het
Other mutations in Zfp976
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Zfp976 APN 7 42613685 missense unknown
IGL01102:Zfp976 APN 7 42613909 nonsense probably null
IGL01111:Zfp976 APN 7 42616287 missense probably damaging 0.99
IGL01628:Zfp976 APN 7 42612511 missense unknown
IGL02008:Zfp976 APN 7 42614232 splice site probably benign
IGL02548:Zfp976 APN 7 42612529 missense unknown
R0190:Zfp976 UTSW 7 42642524 start gained probably benign
R0685:Zfp976 UTSW 7 42613717 missense probably damaging 0.98
R1310:Zfp976 UTSW 7 42613186 missense probably damaging 1.00
R1353:Zfp976 UTSW 7 42616018 missense probably damaging 0.99
R1447:Zfp976 UTSW 7 42612599 missense possibly damaging 0.79
R1569:Zfp976 UTSW 7 42613382 missense probably damaging 1.00
R1702:Zfp976 UTSW 7 42616000 missense possibly damaging 0.86
R1829:Zfp976 UTSW 7 42616311 missense probably damaging 1.00
R1939:Zfp976 UTSW 7 42613681 missense unknown
R1978:Zfp976 UTSW 7 42613841 missense probably damaging 1.00
R1981:Zfp976 UTSW 7 42613622 missense probably damaging 0.99
R2160:Zfp976 UTSW 7 42613930 missense probably benign
R2192:Zfp976 UTSW 7 42613271 missense probably damaging 1.00
R3121:Zfp976 UTSW 7 42613514 missense probably damaging 1.00
R4210:Zfp976 UTSW 7 42616325 missense probably damaging 0.99
R4724:Zfp976 UTSW 7 42613033 missense possibly damaging 0.91
R4943:Zfp976 UTSW 7 42612422 unclassified probably benign
R5047:Zfp976 UTSW 7 42613419 nonsense probably null
R5071:Zfp976 UTSW 7 42612930 nonsense probably null
R5125:Zfp976 UTSW 7 42612501 unclassified probably null
R5178:Zfp976 UTSW 7 42612501 unclassified probably null
R5305:Zfp976 UTSW 7 42613478 missense probably benign 0.00
R5777:Zfp976 UTSW 7 42614080 missense probably benign 0.00
R6153:Zfp976 UTSW 7 42614186 missense probably damaging 0.99
R6694:Zfp976 UTSW 7 42614186 missense probably damaging 0.99
R7226:Zfp976 UTSW 7 42613260 nonsense probably null
R7561:Zfp976 UTSW 7 42616277 missense probably damaging 1.00
Z1088:Zfp976 UTSW 7 42612760 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- GCATTCGAAGATAGCTGGGAT -3'
(R):5'- ACCTTCGAGCACATGAAAGAACA -3'

Sequencing Primer
(F):5'- TGGGATTGCAAAAAGGCTTTACCAC -3'
(R):5'- TTCGAGCACATGAAAGAACACATAC -3'
Posted On2019-10-07