Incidental Mutation 'R7479:Vps35'
ID579678
Institutional Source Beutler Lab
Gene Symbol Vps35
Ensembl Gene ENSMUSG00000031696
Gene NameVPS35 retromer complex component
SynonymsMem3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7479 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location85260392-85299802 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 85270805 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 512 (T512K)
Ref Sequence ENSEMBL: ENSMUSP00000034131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034131]
Predicted Effect probably benign
Transcript: ENSMUST00000034131
AA Change: T512K

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000034131
Gene: ENSMUSG00000031696
AA Change: T512K

DomainStartEndE-ValueType
Pfam:Vps35 15 753 6.8e-303 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a group of vacuolar protein sorting (VPS) genes. The encoded protein is a component of a large multimeric complex, termed the retromer complex, involved in retrograde transport of proteins from endosomes to the trans-Golgi network. The close structural similarity between the yeast and human proteins that make up this complex suggests a similarity in function. Expression studies in yeast and mammalian cells indicate that this protein interacts directly with VPS35, which serves as the core of the retromer complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to E10. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,578,493 M81L probably benign Het
Ano9 T C 7: 141,102,435 T667A probably damaging Het
Anpep T A 7: 79,835,370 I623F probably benign Het
Apba2 T C 7: 64,739,859 I501T possibly damaging Het
Ascc3 T A 10: 50,649,799 Y536N probably damaging Het
B4galt1 T C 4: 40,823,587 Y168C probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C2 A G 17: 34,863,465 C647R probably damaging Het
Cnot4 G A 6: 35,024,148 T604I probably benign Het
Col11a1 C T 3: 114,102,569 T506I unknown Het
Cr2 A C 1: 195,158,410 probably null Het
Ctsm A T 13: 61,537,755 V281D probably damaging Het
Cyp2c69 T C 19: 39,881,557 I74V probably benign Het
Dennd4c T A 4: 86,799,353 V529D probably damaging Het
Dlgap3 C A 4: 127,194,625 H5N possibly damaging Het
Dusp10 C A 1: 184,037,420 H194Q probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eln C G 5: 134,707,575 G753A unknown Het
Emb T A 13: 117,249,426 N118K possibly damaging Het
Fam184a C T 10: 53,655,014 V755I probably benign Het
Fryl A G 5: 73,097,561 I846T possibly damaging Het
Gabbr2 T A 4: 46,681,166 I722F probably damaging Het
Gabrb3 T A 7: 57,824,423 D362E possibly damaging Het
Galnt2 G A 8: 124,334,338 G357D probably damaging Het
Gbx2 A T 1: 89,930,651 S35R probably benign Het
Glg1 A G 8: 111,197,735 I207T possibly damaging Het
Gm10192 A T 4: 97,183,035 N44K unknown Het
Gpd1 A G 15: 99,720,103 D123G probably benign Het
Grm2 A T 9: 106,653,851 D146E possibly damaging Het
Gsg1l2 A G 11: 67,785,206 D132G probably benign Het
Hecw1 C T 13: 14,340,840 G236R probably damaging Het
Hif3a G A 7: 17,042,635 T462I possibly damaging Het
Hspg2 C T 4: 137,539,403 A1934V probably benign Het
Il7r C T 15: 9,513,031 A131T probably damaging Het
Itga6 C T 2: 71,838,336 R540* probably null Het
Kcnh2 A G 5: 24,325,492 probably null Het
Kcnq4 C T 4: 120,715,825 A260T probably damaging Het
Lrp1b T C 2: 40,801,505 N3434S Het
Lrrc41 C T 4: 116,089,041 P318S probably damaging Het
Map4 G A 9: 110,068,824 G873R possibly damaging Het
Med24 A G 11: 98,704,961 I968T possibly damaging Het
Mfap5 T C 6: 122,526,862 probably null Het
Mtcl1 A G 17: 66,379,490 V807A probably benign Het
Mug1 T A 6: 121,878,508 S934T possibly damaging Het
Nckap5l C A 15: 99,423,246 V1218F probably damaging Het
Nek1 T A 8: 61,130,145 D1272E probably benign Het
Nkx2-4 T C 2: 147,084,168 E258G probably benign Het
Polr1a T A 6: 71,936,297 V545E probably damaging Het
Ppp1r9b A G 11: 94,992,032 D162G possibly damaging Het
Rhot2 A G 17: 25,840,749 L367P probably damaging Het
Ripk2 A G 4: 16,155,154 F122L probably benign Het
Scn11a T C 9: 119,759,875 T1322A probably benign Het
Scn8a T A 15: 100,955,477 L115Q probably damaging Het
Sel1l3 G T 5: 53,117,120 P1006Q probably damaging Het
Sept11 A T 5: 93,156,945 N207I probably damaging Het
Sez6l2 C T 7: 126,963,659 T669I probably damaging Het
Sfxn4 T A 19: 60,858,674 D57V possibly damaging Het
Smarca2 T A 19: 26,640,487 V306D probably benign Het
Srgap3 C T 6: 112,735,833 probably null Het
Tas2r134 T C 2: 51,627,529 F7L not run Het
Tbcd T C 11: 121,492,605 probably null Het
Tcn2 G A 11: 3,917,703 A413V probably damaging Het
Tdp1 T C 12: 99,891,395 V71A probably benign Het
Tjp1 T C 7: 65,301,180 T1649A probably damaging Het
Tnc T C 4: 64,017,628 E357G possibly damaging Het
Tnrc6b A G 15: 80,889,126 T1158A probably benign Het
Ttn C A 2: 76,738,608 E27314* probably null Het
Zfp40 A T 17: 23,177,318 S98R probably benign Het
Zfp945 A T 17: 22,851,366 C541S possibly damaging Het
Zfp976 T A 7: 42,613,179 E412D probably benign Het
Other mutations in Vps35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01745:Vps35 APN 8 85273463 splice site probably benign
IGL02604:Vps35 APN 8 85286389 missense probably damaging 1.00
IGL03278:Vps35 APN 8 85294961 unclassified probably benign
IGL03326:Vps35 APN 8 85274897 nonsense probably null
PIT4151001:Vps35 UTSW 8 85284048 missense possibly damaging 0.95
R0118:Vps35 UTSW 8 85294953 missense probably benign 0.04
R0226:Vps35 UTSW 8 85273575 missense probably damaging 0.97
R1079:Vps35 UTSW 8 85279054 missense probably damaging 1.00
R1477:Vps35 UTSW 8 85287800 missense probably damaging 1.00
R1969:Vps35 UTSW 8 85278994 missense possibly damaging 0.90
R2082:Vps35 UTSW 8 85263465 missense possibly damaging 0.95
R2156:Vps35 UTSW 8 85286500 missense probably benign 0.06
R2341:Vps35 UTSW 8 85274814 splice site probably benign
R3752:Vps35 UTSW 8 85274831 missense probably benign 0.34
R4589:Vps35 UTSW 8 85287702 missense probably damaging 1.00
R4745:Vps35 UTSW 8 85261262 missense probably benign
R4790:Vps35 UTSW 8 85278857 splice site probably null
R4827:Vps35 UTSW 8 85273557 missense possibly damaging 0.94
R4953:Vps35 UTSW 8 85281846 missense probably damaging 1.00
R6277:Vps35 UTSW 8 85261228 missense possibly damaging 0.80
R6291:Vps35 UTSW 8 85299457 start codon destroyed probably benign 0.07
R6434:Vps35 UTSW 8 85273495 missense possibly damaging 0.53
R7175:Vps35 UTSW 8 85263560 splice site probably null
R7206:Vps35 UTSW 8 85287721 missense probably damaging 1.00
R7309:Vps35 UTSW 8 85274967 missense probably benign 0.05
R7547:Vps35 UTSW 8 85263370 missense probably damaging 1.00
R7761:Vps35 UTSW 8 85284078 missense possibly damaging 0.91
R7812:Vps35 UTSW 8 85284189 missense probably benign 0.01
R8312:Vps35 UTSW 8 85274869 missense possibly damaging 0.65
R8356:Vps35 UTSW 8 85261305 missense possibly damaging 0.63
R8403:Vps35 UTSW 8 85274858 missense probably benign
R8456:Vps35 UTSW 8 85261305 missense possibly damaging 0.63
X0020:Vps35 UTSW 8 85263421 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCTTGAGCTTTTCTACAACTTAG -3'
(R):5'- AACCCGTGTAAGCTTCCAATTTG -3'

Sequencing Primer
(F):5'- AAGCCAACTGGTAAGCTG -3'
(R):5'- GTGTACTTCAGTAAAGCCTG -3'
Posted On2019-10-07