Mutagenetix > Incidental Mutation

Incidental Mutation 'R7479:Scn11a'

579683

Institutional Source

Beutler Lab

Gene Symbol

Scn11a

Ensembl Gene

ENSMUSG00000034115

Gene Name

sodium channel, voltage-gated, type XI, alpha

Synonyms

NaN, NSS2, NaT, SNS2

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.095) question?

Stock #

R7479 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

119753759-119825456 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 119759875 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1322 (T1322A)

Ref Sequence

ENSEMBL: ENSMUSP00000065466 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070617] [ENSMUST00000215718]

AlphaFold

Q9R053

Predicted Effect

probably benign
Transcript: ENSMUST00000070617
AA Change: T1322A

PolyPhen 2 Score 0.383 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000065466
Gene: ENSMUSG00000034115
AA Change: T1322A

Domain	Start	End	E-Value	Type
low complexity region	27	43	N/A	INTRINSIC
Pfam:Ion_trans	128	409	1.1e-72	PFAM
low complexity region	475	487	N/A	INTRINSIC
Pfam:Ion_trans	574	810	4e-57	PFAM
Pfam:Na_trans_assoc	814	1030	4.1e-29	PFAM
Pfam:Ion_trans	1034	1300	5.7e-66	PFAM
Pfam:Ion_trans	1346	1595	3e-58	PFAM
low complexity region	1683	1694	N/A	INTRINSIC
low complexity region	1733	1744	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000215718
AA Change: T1322A

PolyPhen 2 Score 0.383 (Sensitivity: 0.90; Specificity: 0.89)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous and heterozygous for one null allele display decreased duration of inflammation induced thermal hyperalgesia and decreased late phase pain responses to inflammatory stimuli. Mice homozygous for a second allele appear normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003H04Rik	T	A	3: 124,578,493	M81L	probably benign	Het
Ano9	T	C	7: 141,102,435	T667A	probably damaging	Het
Anpep	T	A	7: 79,835,370	I623F	probably benign	Het
Apba2	T	C	7: 64,739,859	I501T	possibly damaging	Het
Ascc3	T	A	10: 50,649,799	Y536N	probably damaging	Het
B4galt1	T	C	4: 40,823,587	Y168C	probably damaging	Het
C1ra	G	A	6: 124,517,725	E316K	probably benign	Het
C2	A	G	17: 34,863,465	C647R	probably damaging	Het
Cnot4	G	A	6: 35,024,148	T604I	probably benign	Het
Col11a1	C	T	3: 114,102,569	T506I	unknown	Het
Cr2	A	C	1: 195,158,410		probably null	Het
Ctsm	A	T	13: 61,537,755	V281D	probably damaging	Het
Cyp2c69	T	C	19: 39,881,557	I74V	probably benign	Het
Dennd4c	T	A	4: 86,799,353	V529D	probably damaging	Het
Dlgap3	C	A	4: 127,194,625	H5N	possibly damaging	Het
Dusp10	C	A	1: 184,037,420	H194Q	probably damaging	Het
E430018J23Rik	C	T	7: 127,393,324	C38Y	probably null	Het
Eln	C	G	5: 134,707,575	G753A	unknown	Het
Emb	T	A	13: 117,249,426	N118K	possibly damaging	Het
Fam184a	C	T	10: 53,655,014	V755I	probably benign	Het
Fryl	A	G	5: 73,097,561	I846T	possibly damaging	Het
Gabbr2	T	A	4: 46,681,166	I722F	probably damaging	Het
Gabrb3	T	A	7: 57,824,423	D362E	possibly damaging	Het
Galnt2	G	A	8: 124,334,338	G357D	probably damaging	Het
Gbx2	A	T	1: 89,930,651	S35R	probably benign	Het
Glg1	A	G	8: 111,197,735	I207T	possibly damaging	Het
Gm10192	A	T	4: 97,183,035	N44K	unknown	Het
Gpd1	A	G	15: 99,720,103	D123G	probably benign	Het
Grm2	A	T	9: 106,653,851	D146E	possibly damaging	Het
Gsg1l2	A	G	11: 67,785,206	D132G	probably benign	Het
Hecw1	C	T	13: 14,340,840	G236R	probably damaging	Het
Hif3a	G	A	7: 17,042,635	T462I	possibly damaging	Het
Hspg2	C	T	4: 137,539,403	A1934V	probably benign	Het
Il7r	C	T	15: 9,513,031	A131T	probably damaging	Het
Itga6	C	T	2: 71,838,336	R540*	probably null	Het
Kcnh2	A	G	5: 24,325,492		probably null	Het
Kcnq4	C	T	4: 120,715,825	A260T	probably damaging	Het
Lrp1b	T	C	2: 40,801,505	N3434S		Het
Lrrc41	C	T	4: 116,089,041	P318S	probably damaging	Het
Map4	G	A	9: 110,068,824	G873R	possibly damaging	Het
Med24	A	G	11: 98,704,961	I968T	possibly damaging	Het
Mfap5	T	C	6: 122,526,862		probably null	Het
Mtcl1	A	G	17: 66,379,490	V807A	probably benign	Het
Mug1	T	A	6: 121,878,508	S934T	possibly damaging	Het
Nckap5l	C	A	15: 99,423,246	V1218F	probably damaging	Het
Nek1	T	A	8: 61,130,145	D1272E	probably benign	Het
Nkx2-4	T	C	2: 147,084,168	E258G	probably benign	Het
Polr1a	T	A	6: 71,936,297	V545E	probably damaging	Het
Ppp1r9b	A	G	11: 94,992,032	D162G	possibly damaging	Het
Rhot2	A	G	17: 25,840,749	L367P	probably damaging	Het
Ripk2	A	G	4: 16,155,154	F122L	probably benign	Het
Scn8a	T	A	15: 100,955,477	L115Q	probably damaging	Het
Sel1l3	G	T	5: 53,117,120	P1006Q	probably damaging	Het
Sept11	A	T	5: 93,156,945	N207I	probably damaging	Het
Sez6l2	C	T	7: 126,963,659	T669I	probably damaging	Het
Sfxn4	T	A	19: 60,858,674	D57V	possibly damaging	Het
Smarca2	T	A	19: 26,640,487	V306D	probably benign	Het
Srgap3	C	T	6: 112,735,833		probably null	Het
Tas2r134	T	C	2: 51,627,529	F7L	not run	Het
Tbcd	T	C	11: 121,492,605		probably null	Het
Tcn2	G	A	11: 3,917,703	A413V	probably damaging	Het
Tdp1	T	C	12: 99,891,395	V71A	probably benign	Het
Tjp1	T	C	7: 65,301,180	T1649A	probably damaging	Het
Tnc	T	C	4: 64,017,628	E357G	possibly damaging	Het
Tnrc6b	A	G	15: 80,889,126	T1158A	probably benign	Het
Ttn	C	A	2: 76,738,608	E27314*	probably null	Het
Vps35	G	T	8: 85,270,805	T512K	probably benign	Het
Zfp40	A	T	17: 23,177,318	S98R	probably benign	Het
Zfp945	A	T	17: 22,851,366	C541S	possibly damaging	Het
Zfp976	T	A	7: 42,613,179	E412D	probably benign	Het

Other mutations in Scn11a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Scn11a	APN	9	119770506	missense	probably benign	0.00
IGL00272:Scn11a	APN	9	119816603	missense	probably damaging	0.98
IGL00332:Scn11a	APN	9	119769916	missense	probably damaging	1.00
IGL00533:Scn11a	APN	9	119774381	missense	probably damaging	1.00
IGL00972:Scn11a	APN	9	119793938	missense	probably benign	0.44
IGL01338:Scn11a	APN	9	119784161	splice site	probably benign
IGL01534:Scn11a	APN	9	119780822	missense	probably benign	0.27
IGL01838:Scn11a	APN	9	119758583	missense	probably damaging	1.00
IGL01991:Scn11a	APN	9	119819904	missense	probably damaging	0.97
IGL02057:Scn11a	APN	9	119765470	missense	probably damaging	1.00
IGL02290:Scn11a	APN	9	119774442	missense	probably damaging	0.97
IGL02454:Scn11a	APN	9	119758544	missense	probably benign	0.00
IGL02517:Scn11a	APN	9	119792398	missense	probably damaging	1.00
IGL02567:Scn11a	APN	9	119804489	missense	probably damaging	0.99
IGL02587:Scn11a	APN	9	119805684	missense	probably damaging	1.00
IGL03069:Scn11a	APN	9	119789963	missense	probably benign	0.16
IGL03171:Scn11a	APN	9	119819847	missense	probably benign	0.00
Kleinie	UTSW	9	119803503	missense	probably benign	0.16
H8441:Scn11a	UTSW	9	119807910	missense	probably damaging	1.00
PIT4449001:Scn11a	UTSW	9	119769948	missense	probably damaging	1.00
R0304:Scn11a	UTSW	9	119819862	missense	probably benign	0.00
R0519:Scn11a	UTSW	9	119790119	missense	probably damaging	1.00
R0658:Scn11a	UTSW	9	119811160	missense	probably benign	0.41
R0828:Scn11a	UTSW	9	119755007	missense	probably benign	0.00
R0893:Scn11a	UTSW	9	119803330	splice site	probably null
R0932:Scn11a	UTSW	9	119807810	missense	probably damaging	1.00
R1061:Scn11a	UTSW	9	119795663	missense	probably damaging	0.98
R1161:Scn11a	UTSW	9	119755057	nonsense	probably null
R1162:Scn11a	UTSW	9	119805644	splice site	probably benign
R1310:Scn11a	UTSW	9	119755057	nonsense	probably null
R1589:Scn11a	UTSW	9	119769807	missense	probably damaging	1.00
R1681:Scn11a	UTSW	9	119804412	missense	possibly damaging	0.46
R1781:Scn11a	UTSW	9	119755082	missense	probably damaging	1.00
R1812:Scn11a	UTSW	9	119780865	nonsense	probably null
R1901:Scn11a	UTSW	9	119779036	nonsense	probably null
R1978:Scn11a	UTSW	9	119780795	nonsense	probably null
R1985:Scn11a	UTSW	9	119754678	missense	probably benign	0.19
R2022:Scn11a	UTSW	9	119811208	missense	possibly damaging	0.88
R2072:Scn11a	UTSW	9	119811208	missense	possibly damaging	0.88
R2098:Scn11a	UTSW	9	119792494	missense	possibly damaging	0.67
R2163:Scn11a	UTSW	9	119755025	missense	probably damaging	1.00
R2250:Scn11a	UTSW	9	119758602	missense	probably benign	0.01
R2373:Scn11a	UTSW	9	119813186	missense	probably benign	0.43
R2508:Scn11a	UTSW	9	119765529	missense	probably damaging	1.00
R3757:Scn11a	UTSW	9	119803503	missense	probably benign	0.16
R3767:Scn11a	UTSW	9	119784049	missense	probably damaging	1.00
R3770:Scn11a	UTSW	9	119784049	missense	probably damaging	1.00
R4089:Scn11a	UTSW	9	119795653	splice site	probably null
R4092:Scn11a	UTSW	9	119789970	missense	probably benign	0.03
R4247:Scn11a	UTSW	9	119807886	missense	probably damaging	1.00
R4279:Scn11a	UTSW	9	119754362	missense	probably benign	0.25
R4299:Scn11a	UTSW	9	119765506	missense	probably damaging	0.97
R4403:Scn11a	UTSW	9	119795667	missense	probably damaging	1.00
R4468:Scn11a	UTSW	9	119754987	missense	probably damaging	1.00
R4542:Scn11a	UTSW	9	119755134	missense	probably damaging	1.00
R4644:Scn11a	UTSW	9	119815203	splice site	probably null
R4739:Scn11a	UTSW	9	119754561	missense	probably benign	0.39
R4809:Scn11a	UTSW	9	119819870	missense	probably benign	0.00
R4954:Scn11a	UTSW	9	119758659	missense	possibly damaging	0.84
R5012:Scn11a	UTSW	9	119780878	missense	probably benign	0.31
R5044:Scn11a	UTSW	9	119819831	missense	probably damaging	0.98
R5222:Scn11a	UTSW	9	119815202	splice site	probably null
R5224:Scn11a	UTSW	9	119754792	missense	probably damaging	1.00
R5400:Scn11a	UTSW	9	119769908	missense	probably damaging	0.97
R5555:Scn11a	UTSW	9	119755238	missense	probably damaging	1.00
R5711:Scn11a	UTSW	9	119789924	missense	probably damaging	1.00
R5950:Scn11a	UTSW	9	119811124	missense	probably damaging	1.00
R5984:Scn11a	UTSW	9	119784016	missense	probably benign
R6057:Scn11a	UTSW	9	119765448	missense	probably damaging	1.00
R6104:Scn11a	UTSW	9	119795678	missense	probably damaging	1.00
R6180:Scn11a	UTSW	9	119754867	missense	probably benign	0.00
R6892:Scn11a	UTSW	9	119806969	missense	possibly damaging	0.53
R6908:Scn11a	UTSW	9	119792426	missense	probably damaging	1.00
R6949:Scn11a	UTSW	9	119765514	missense	probably benign	0.04
R7112:Scn11a	UTSW	9	119754809	missense	probably damaging	1.00
R7232:Scn11a	UTSW	9	119759916	missense	probably damaging	1.00
R7261:Scn11a	UTSW	9	119819833	missense	probably damaging	0.99
R7265:Scn11a	UTSW	9	119815265	missense	probably damaging	1.00
R7302:Scn11a	UTSW	9	119806951	missense	probably benign	0.03
R7391:Scn11a	UTSW	9	119795717	missense	probably damaging	1.00
R7441:Scn11a	UTSW	9	119758626	missense	probably benign	0.01
R7608:Scn11a	UTSW	9	119815313	splice site	probably null
R7768:Scn11a	UTSW	9	119815272	missense	probably benign	0.13
R7785:Scn11a	UTSW	9	119816556	missense	probably benign	0.00
R7794:Scn11a	UTSW	9	119765514	missense	probably damaging	0.99
R7818:Scn11a	UTSW	9	119784111	missense	probably damaging	0.97
R7884:Scn11a	UTSW	9	119804551	missense	probably benign	0.01
R7988:Scn11a	UTSW	9	119765437	missense	probably damaging	0.97
R8049:Scn11a	UTSW	9	119755083	missense	probably damaging	1.00
R8127:Scn11a	UTSW	9	119804512	missense	probably damaging	1.00
R8274:Scn11a	UTSW	9	119803482	missense	probably benign
R8344:Scn11a	UTSW	9	119781970	missense	probably benign	0.00
R8346:Scn11a	UTSW	9	119778981	missense	probably damaging	1.00
R8511:Scn11a	UTSW	9	119789915	missense	probably damaging	0.99
R8819:Scn11a	UTSW	9	119816520	missense	probably benign	0.19
R8820:Scn11a	UTSW	9	119816520	missense	probably benign	0.19
R8837:Scn11a	UTSW	9	119792344	missense	probably damaging	1.00
R8913:Scn11a	UTSW	9	119794028	missense	probably damaging	1.00
R8915:Scn11a	UTSW	9	119774297	nonsense	probably null
R8975:Scn11a	UTSW	9	119758499	missense	probably damaging	1.00
R9156:Scn11a	UTSW	9	119759923	missense	possibly damaging	0.75
R9222:Scn11a	UTSW	9	119781947	missense	probably damaging	0.98
R9355:Scn11a	UTSW	9	119755094	missense	probably damaging	1.00
R9486:Scn11a	UTSW	9	119795708	missense	possibly damaging	0.86
R9712:Scn11a	UTSW	9	119790010	nonsense	probably null
R9766:Scn11a	UTSW	9	119755115	missense	probably damaging	1.00
Z1088:Scn11a	UTSW	9	119755242	missense	probably damaging	1.00
Z1177:Scn11a	UTSW	9	119754998	missense	possibly damaging	0.94
Z1177:Scn11a	UTSW	9	119819820	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTAAGAACTTGGGTGCATCTTG -3'
(R):5'- TCAAGTTCCTTTGGAAGAGGAAC -3'

Sequencing Primer
(F):5'- TCACGAATGACTGCTCTGAG -3'
(R):5'- AGTTCCTTTGGAAGAGGAACTATTG -3'

Posted On

2019-10-07