Incidental Mutation 'R7479:Scn11a'
ID 579683
Institutional Source Beutler Lab
Gene Symbol Scn11a
Ensembl Gene ENSMUSG00000034115
Gene Name sodium channel, voltage-gated, type XI, alpha
Synonyms NaN, NSS2, NaT, SNS2
MMRRC Submission 045553-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.091) question?
Stock # R7479 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 119582829-119654522 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 119588941 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1322 (T1322A)
Ref Sequence ENSEMBL: ENSMUSP00000065466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070617] [ENSMUST00000215718]
AlphaFold Q9R053
Predicted Effect probably benign
Transcript: ENSMUST00000070617
AA Change: T1322A

PolyPhen 2 Score 0.383 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000065466
Gene: ENSMUSG00000034115
AA Change: T1322A

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:Ion_trans 128 409 1.1e-72 PFAM
low complexity region 475 487 N/A INTRINSIC
Pfam:Ion_trans 574 810 4e-57 PFAM
Pfam:Na_trans_assoc 814 1030 4.1e-29 PFAM
Pfam:Ion_trans 1034 1300 5.7e-66 PFAM
Pfam:Ion_trans 1346 1595 3e-58 PFAM
low complexity region 1683 1694 N/A INTRINSIC
low complexity region 1733 1744 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215718
AA Change: T1322A

PolyPhen 2 Score 0.383 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous and heterozygous for one null allele display decreased duration of inflammation induced thermal hyperalgesia and decreased late phase pain responses to inflammatory stimuli. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,372,142 (GRCm39) M81L probably benign Het
Ano9 T C 7: 140,682,348 (GRCm39) T667A probably damaging Het
Anpep T A 7: 79,485,118 (GRCm39) I623F probably benign Het
Apba2 T C 7: 64,389,607 (GRCm39) I501T possibly damaging Het
Ascc3 T A 10: 50,525,895 (GRCm39) Y536N probably damaging Het
B4galt1 T C 4: 40,823,587 (GRCm39) Y168C probably damaging Het
C1ra G A 6: 124,494,684 (GRCm39) E316K probably benign Het
C2 A G 17: 35,082,441 (GRCm39) C647R probably damaging Het
Cnot4 G A 6: 35,001,083 (GRCm39) T604I probably benign Het
Col11a1 C T 3: 113,896,218 (GRCm39) T506I unknown Het
Cr2 A C 1: 194,840,718 (GRCm39) probably null Het
Ctsm A T 13: 61,685,569 (GRCm39) V281D probably damaging Het
Cyp2c69 T C 19: 39,870,001 (GRCm39) I74V probably benign Het
Dennd4c T A 4: 86,717,590 (GRCm39) V529D probably damaging Het
Dlgap3 C A 4: 127,088,418 (GRCm39) H5N possibly damaging Het
Dusp10 C A 1: 183,769,617 (GRCm39) H194Q probably damaging Het
Eln C G 5: 134,736,429 (GRCm39) G753A unknown Het
Emb T A 13: 117,385,962 (GRCm39) N118K possibly damaging Het
Fam184a C T 10: 53,531,110 (GRCm39) V755I probably benign Het
Fryl A G 5: 73,254,904 (GRCm39) I846T possibly damaging Het
Gabbr2 T A 4: 46,681,166 (GRCm39) I722F probably damaging Het
Gabrb3 T A 7: 57,474,171 (GRCm39) D362E possibly damaging Het
Galnt2 G A 8: 125,061,077 (GRCm39) G357D probably damaging Het
Gbx2 A T 1: 89,858,373 (GRCm39) S35R probably benign Het
Glg1 A G 8: 111,924,367 (GRCm39) I207T possibly damaging Het
Gm10192 A T 4: 97,071,272 (GRCm39) N44K unknown Het
Gpd1 A G 15: 99,617,984 (GRCm39) D123G probably benign Het
Grm2 A T 9: 106,531,050 (GRCm39) D146E possibly damaging Het
Gsg1l2 A G 11: 67,676,032 (GRCm39) D132G probably benign Het
Hecw1 C T 13: 14,515,425 (GRCm39) G236R probably damaging Het
Hif3a G A 7: 16,776,560 (GRCm39) T462I possibly damaging Het
Hspg2 C T 4: 137,266,714 (GRCm39) A1934V probably benign Het
Il7r C T 15: 9,513,117 (GRCm39) A131T probably damaging Het
Itga6 C T 2: 71,668,680 (GRCm39) R540* probably null Het
Kcnh2 A G 5: 24,530,490 (GRCm39) probably null Het
Kcnq4 C T 4: 120,573,022 (GRCm39) A260T probably damaging Het
Lrp1b T C 2: 40,691,517 (GRCm39) N3434S Het
Lrrc41 C T 4: 115,946,238 (GRCm39) P318S probably damaging Het
Map4 G A 9: 109,897,892 (GRCm39) G873R possibly damaging Het
Med24 A G 11: 98,595,787 (GRCm39) I968T possibly damaging Het
Mfap5 T C 6: 122,503,821 (GRCm39) probably null Het
Mtcl1 A G 17: 66,686,485 (GRCm39) V807A probably benign Het
Mug1 T A 6: 121,855,467 (GRCm39) S934T possibly damaging Het
Nckap5l C A 15: 99,321,127 (GRCm39) V1218F probably damaging Het
Nek1 T A 8: 61,583,179 (GRCm39) D1272E probably benign Het
Nkx2-4 T C 2: 146,926,088 (GRCm39) E258G probably benign Het
Polr1a T A 6: 71,913,281 (GRCm39) V545E probably damaging Het
Ppp1r9b A G 11: 94,882,858 (GRCm39) D162G possibly damaging Het
Rhot2 A G 17: 26,059,723 (GRCm39) L367P probably damaging Het
Ripk2 A G 4: 16,155,154 (GRCm39) F122L probably benign Het
Scn8a T A 15: 100,853,358 (GRCm39) L115Q probably damaging Het
Sel1l3 G T 5: 53,274,462 (GRCm39) P1006Q probably damaging Het
Septin11 A T 5: 93,304,804 (GRCm39) N207I probably damaging Het
Sez6l2 C T 7: 126,562,831 (GRCm39) T669I probably damaging Het
Sfxn4 T A 19: 60,847,112 (GRCm39) D57V possibly damaging Het
Smarca2 T A 19: 26,617,887 (GRCm39) V306D probably benign Het
Srgap3 C T 6: 112,712,794 (GRCm39) probably null Het
Tas2r134 T C 2: 51,517,541 (GRCm39) F7L not run Het
Tbcd T C 11: 121,383,431 (GRCm39) probably null Het
Tcn2 G A 11: 3,867,703 (GRCm39) A413V probably damaging Het
Tdp1 T C 12: 99,857,654 (GRCm39) V71A probably benign Het
Tjp1 T C 7: 64,950,928 (GRCm39) T1649A probably damaging Het
Tnc T C 4: 63,935,865 (GRCm39) E357G possibly damaging Het
Tnrc6b A G 15: 80,773,327 (GRCm39) T1158A probably benign Het
Ttn C A 2: 76,568,952 (GRCm39) E27314* probably null Het
Vps35 G T 8: 85,997,434 (GRCm39) T512K probably benign Het
Zfp40 A T 17: 23,396,292 (GRCm39) S98R probably benign Het
Zfp764l1 C T 7: 126,992,496 (GRCm39) C38Y probably null Het
Zfp945 A T 17: 23,070,340 (GRCm39) C541S possibly damaging Het
Zfp976 T A 7: 42,262,603 (GRCm39) E412D probably benign Het
Other mutations in Scn11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Scn11a APN 9 119,599,572 (GRCm39) missense probably benign 0.00
IGL00272:Scn11a APN 9 119,645,669 (GRCm39) missense probably damaging 0.98
IGL00332:Scn11a APN 9 119,598,982 (GRCm39) missense probably damaging 1.00
IGL00533:Scn11a APN 9 119,603,447 (GRCm39) missense probably damaging 1.00
IGL00972:Scn11a APN 9 119,623,004 (GRCm39) missense probably benign 0.44
IGL01338:Scn11a APN 9 119,613,227 (GRCm39) splice site probably benign
IGL01534:Scn11a APN 9 119,609,888 (GRCm39) missense probably benign 0.27
IGL01838:Scn11a APN 9 119,587,649 (GRCm39) missense probably damaging 1.00
IGL01991:Scn11a APN 9 119,648,970 (GRCm39) missense probably damaging 0.97
IGL02057:Scn11a APN 9 119,594,536 (GRCm39) missense probably damaging 1.00
IGL02290:Scn11a APN 9 119,603,508 (GRCm39) missense probably damaging 0.97
IGL02454:Scn11a APN 9 119,587,610 (GRCm39) missense probably benign 0.00
IGL02517:Scn11a APN 9 119,621,464 (GRCm39) missense probably damaging 1.00
IGL02567:Scn11a APN 9 119,633,555 (GRCm39) missense probably damaging 0.99
IGL02587:Scn11a APN 9 119,634,750 (GRCm39) missense probably damaging 1.00
IGL03069:Scn11a APN 9 119,619,029 (GRCm39) missense probably benign 0.16
IGL03171:Scn11a APN 9 119,648,913 (GRCm39) missense probably benign 0.00
Kleinie UTSW 9 119,632,569 (GRCm39) missense probably benign 0.16
H8441:Scn11a UTSW 9 119,636,976 (GRCm39) missense probably damaging 1.00
PIT4449001:Scn11a UTSW 9 119,599,014 (GRCm39) missense probably damaging 1.00
R0304:Scn11a UTSW 9 119,648,928 (GRCm39) missense probably benign 0.00
R0519:Scn11a UTSW 9 119,619,185 (GRCm39) missense probably damaging 1.00
R0658:Scn11a UTSW 9 119,640,226 (GRCm39) missense probably benign 0.41
R0828:Scn11a UTSW 9 119,584,073 (GRCm39) missense probably benign 0.00
R0893:Scn11a UTSW 9 119,632,396 (GRCm39) splice site probably null
R0932:Scn11a UTSW 9 119,636,876 (GRCm39) missense probably damaging 1.00
R1061:Scn11a UTSW 9 119,624,729 (GRCm39) missense probably damaging 0.98
R1161:Scn11a UTSW 9 119,584,123 (GRCm39) nonsense probably null
R1162:Scn11a UTSW 9 119,634,710 (GRCm39) splice site probably benign
R1310:Scn11a UTSW 9 119,584,123 (GRCm39) nonsense probably null
R1589:Scn11a UTSW 9 119,598,873 (GRCm39) missense probably damaging 1.00
R1681:Scn11a UTSW 9 119,633,478 (GRCm39) missense possibly damaging 0.46
R1781:Scn11a UTSW 9 119,584,148 (GRCm39) missense probably damaging 1.00
R1812:Scn11a UTSW 9 119,609,931 (GRCm39) nonsense probably null
R1901:Scn11a UTSW 9 119,608,102 (GRCm39) nonsense probably null
R1978:Scn11a UTSW 9 119,609,861 (GRCm39) nonsense probably null
R1985:Scn11a UTSW 9 119,583,744 (GRCm39) missense probably benign 0.19
R2022:Scn11a UTSW 9 119,640,274 (GRCm39) missense possibly damaging 0.88
R2072:Scn11a UTSW 9 119,640,274 (GRCm39) missense possibly damaging 0.88
R2098:Scn11a UTSW 9 119,621,560 (GRCm39) missense possibly damaging 0.67
R2163:Scn11a UTSW 9 119,584,091 (GRCm39) missense probably damaging 1.00
R2250:Scn11a UTSW 9 119,587,668 (GRCm39) missense probably benign 0.01
R2373:Scn11a UTSW 9 119,642,252 (GRCm39) missense probably benign 0.43
R2508:Scn11a UTSW 9 119,594,595 (GRCm39) missense probably damaging 1.00
R3757:Scn11a UTSW 9 119,632,569 (GRCm39) missense probably benign 0.16
R3767:Scn11a UTSW 9 119,613,115 (GRCm39) missense probably damaging 1.00
R3770:Scn11a UTSW 9 119,613,115 (GRCm39) missense probably damaging 1.00
R4089:Scn11a UTSW 9 119,624,719 (GRCm39) splice site probably null
R4092:Scn11a UTSW 9 119,619,036 (GRCm39) missense probably benign 0.03
R4247:Scn11a UTSW 9 119,636,952 (GRCm39) missense probably damaging 1.00
R4279:Scn11a UTSW 9 119,583,428 (GRCm39) missense probably benign 0.25
R4299:Scn11a UTSW 9 119,594,572 (GRCm39) missense probably damaging 0.97
R4403:Scn11a UTSW 9 119,624,733 (GRCm39) missense probably damaging 1.00
R4468:Scn11a UTSW 9 119,584,053 (GRCm39) missense probably damaging 1.00
R4542:Scn11a UTSW 9 119,584,200 (GRCm39) missense probably damaging 1.00
R4644:Scn11a UTSW 9 119,644,269 (GRCm39) splice site probably null
R4739:Scn11a UTSW 9 119,583,627 (GRCm39) missense probably benign 0.39
R4809:Scn11a UTSW 9 119,648,936 (GRCm39) missense probably benign 0.00
R4954:Scn11a UTSW 9 119,587,725 (GRCm39) missense possibly damaging 0.84
R5012:Scn11a UTSW 9 119,609,944 (GRCm39) missense probably benign 0.31
R5044:Scn11a UTSW 9 119,648,897 (GRCm39) missense probably damaging 0.98
R5222:Scn11a UTSW 9 119,644,268 (GRCm39) splice site probably null
R5224:Scn11a UTSW 9 119,583,858 (GRCm39) missense probably damaging 1.00
R5400:Scn11a UTSW 9 119,598,974 (GRCm39) missense probably damaging 0.97
R5555:Scn11a UTSW 9 119,584,304 (GRCm39) missense probably damaging 1.00
R5711:Scn11a UTSW 9 119,618,990 (GRCm39) missense probably damaging 1.00
R5950:Scn11a UTSW 9 119,640,190 (GRCm39) missense probably damaging 1.00
R5984:Scn11a UTSW 9 119,613,082 (GRCm39) missense probably benign
R6057:Scn11a UTSW 9 119,594,514 (GRCm39) missense probably damaging 1.00
R6104:Scn11a UTSW 9 119,624,744 (GRCm39) missense probably damaging 1.00
R6180:Scn11a UTSW 9 119,583,933 (GRCm39) missense probably benign 0.00
R6892:Scn11a UTSW 9 119,636,035 (GRCm39) missense possibly damaging 0.53
R6908:Scn11a UTSW 9 119,621,492 (GRCm39) missense probably damaging 1.00
R6949:Scn11a UTSW 9 119,594,580 (GRCm39) missense probably benign 0.04
R7112:Scn11a UTSW 9 119,583,875 (GRCm39) missense probably damaging 1.00
R7232:Scn11a UTSW 9 119,588,982 (GRCm39) missense probably damaging 1.00
R7261:Scn11a UTSW 9 119,648,899 (GRCm39) missense probably damaging 0.99
R7265:Scn11a UTSW 9 119,644,331 (GRCm39) missense probably damaging 1.00
R7302:Scn11a UTSW 9 119,636,017 (GRCm39) missense probably benign 0.03
R7391:Scn11a UTSW 9 119,624,783 (GRCm39) missense probably damaging 1.00
R7441:Scn11a UTSW 9 119,587,692 (GRCm39) missense probably benign 0.01
R7608:Scn11a UTSW 9 119,644,379 (GRCm39) splice site probably null
R7768:Scn11a UTSW 9 119,644,338 (GRCm39) missense probably benign 0.13
R7785:Scn11a UTSW 9 119,645,622 (GRCm39) missense probably benign 0.00
R7794:Scn11a UTSW 9 119,594,580 (GRCm39) missense probably damaging 0.99
R7818:Scn11a UTSW 9 119,613,177 (GRCm39) missense probably damaging 0.97
R7884:Scn11a UTSW 9 119,633,617 (GRCm39) missense probably benign 0.01
R7988:Scn11a UTSW 9 119,594,503 (GRCm39) missense probably damaging 0.97
R8049:Scn11a UTSW 9 119,584,149 (GRCm39) missense probably damaging 1.00
R8127:Scn11a UTSW 9 119,633,578 (GRCm39) missense probably damaging 1.00
R8274:Scn11a UTSW 9 119,632,548 (GRCm39) missense probably benign
R8344:Scn11a UTSW 9 119,611,036 (GRCm39) missense probably benign 0.00
R8346:Scn11a UTSW 9 119,608,047 (GRCm39) missense probably damaging 1.00
R8511:Scn11a UTSW 9 119,618,981 (GRCm39) missense probably damaging 0.99
R8819:Scn11a UTSW 9 119,645,586 (GRCm39) missense probably benign 0.19
R8820:Scn11a UTSW 9 119,645,586 (GRCm39) missense probably benign 0.19
R8837:Scn11a UTSW 9 119,621,410 (GRCm39) missense probably damaging 1.00
R8913:Scn11a UTSW 9 119,623,094 (GRCm39) missense probably damaging 1.00
R8915:Scn11a UTSW 9 119,603,363 (GRCm39) nonsense probably null
R8975:Scn11a UTSW 9 119,587,565 (GRCm39) missense probably damaging 1.00
R9156:Scn11a UTSW 9 119,588,989 (GRCm39) missense possibly damaging 0.75
R9222:Scn11a UTSW 9 119,611,013 (GRCm39) missense probably damaging 0.98
R9355:Scn11a UTSW 9 119,584,160 (GRCm39) missense probably damaging 1.00
R9486:Scn11a UTSW 9 119,624,774 (GRCm39) missense possibly damaging 0.86
R9712:Scn11a UTSW 9 119,619,076 (GRCm39) nonsense probably null
R9766:Scn11a UTSW 9 119,584,181 (GRCm39) missense probably damaging 1.00
Z1088:Scn11a UTSW 9 119,584,308 (GRCm39) missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119,648,886 (GRCm39) missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119,584,064 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CCTAAGAACTTGGGTGCATCTTG -3'
(R):5'- TCAAGTTCCTTTGGAAGAGGAAC -3'

Sequencing Primer
(F):5'- TCACGAATGACTGCTCTGAG -3'
(R):5'- AGTTCCTTTGGAAGAGGAACTATTG -3'
Posted On 2019-10-07