Incidental Mutation 'R7479:Zfp945'
ID579700
Institutional Source Beutler Lab
Gene Symbol Zfp945
Ensembl Gene ENSMUSG00000059142
Gene Namezinc finger protein 945
SynonymsA630033E08Rik, C730040L01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R7479 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location22846697-22867134 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 22851366 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 541 (C541S)
Ref Sequence ENSEMBL: ENSMUSP00000124123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088696] [ENSMUST00000150092] [ENSMUST00000160457]
Predicted Effect probably damaging
Transcript: ENSMUST00000088696
AA Change: C520S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086074
Gene: ENSMUSG00000059142
AA Change: C520S

DomainStartEndE-ValueType
KRAB 13 68 9.12e-18 SMART
ZnF_C2H2 210 232 1.45e-2 SMART
ZnF_C2H2 238 260 1.03e-2 SMART
ZnF_C2H2 266 288 1.76e-1 SMART
ZnF_C2H2 322 344 7.37e-4 SMART
ZnF_C2H2 350 372 1.5e-4 SMART
ZnF_C2H2 378 400 5.14e-3 SMART
ZnF_C2H2 406 428 9.73e-4 SMART
ZnF_C2H2 434 456 2.99e-4 SMART
ZnF_C2H2 462 484 4.54e-4 SMART
ZnF_C2H2 490 512 2.4e-3 SMART
ZnF_C2H2 518 540 1.38e-3 SMART
ZnF_C2H2 546 568 1.13e-4 SMART
ZnF_C2H2 574 596 5.59e-4 SMART
ZnF_C2H2 602 624 9.31e1 SMART
ZnF_C2H2 630 652 7.9e-4 SMART
ZnF_C2H2 658 680 3.69e-4 SMART
ZnF_C2H2 686 708 3.16e-3 SMART
ZnF_C2H2 714 736 2.95e-3 SMART
ZnF_C2H2 742 764 1.98e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150092
SMART Domains Protein: ENSMUSP00000117978
Gene: ENSMUSG00000059142

DomainStartEndE-ValueType
KRAB 34 89 9.12e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000160457
AA Change: C541S

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124123
Gene: ENSMUSG00000059142
AA Change: C541S

DomainStartEndE-ValueType
KRAB 34 89 9.12e-18 SMART
ZnF_C2H2 231 253 1.45e-2 SMART
ZnF_C2H2 259 281 1.03e-2 SMART
ZnF_C2H2 287 309 1.76e-1 SMART
ZnF_C2H2 343 365 7.37e-4 SMART
ZnF_C2H2 371 393 1.5e-4 SMART
ZnF_C2H2 399 421 5.14e-3 SMART
ZnF_C2H2 427 449 9.73e-4 SMART
ZnF_C2H2 455 477 2.99e-4 SMART
ZnF_C2H2 483 505 4.54e-4 SMART
ZnF_C2H2 511 533 2.4e-3 SMART
ZnF_C2H2 539 561 1.38e-3 SMART
ZnF_C2H2 567 589 1.13e-4 SMART
ZnF_C2H2 595 617 5.59e-4 SMART
ZnF_C2H2 623 645 9.31e1 SMART
ZnF_C2H2 651 673 7.9e-4 SMART
ZnF_C2H2 679 701 3.69e-4 SMART
ZnF_C2H2 707 729 3.16e-3 SMART
ZnF_C2H2 735 757 2.95e-3 SMART
ZnF_C2H2 763 785 1.98e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,578,493 M81L probably benign Het
Ano9 T C 7: 141,102,435 T667A probably damaging Het
Anpep T A 7: 79,835,370 I623F probably benign Het
Apba2 T C 7: 64,739,859 I501T possibly damaging Het
Ascc3 T A 10: 50,649,799 Y536N probably damaging Het
B4galt1 T C 4: 40,823,587 Y168C probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C2 A G 17: 34,863,465 C647R probably damaging Het
Cnot4 G A 6: 35,024,148 T604I probably benign Het
Col11a1 C T 3: 114,102,569 T506I unknown Het
Cr2 A C 1: 195,158,410 probably null Het
Ctsm A T 13: 61,537,755 V281D probably damaging Het
Cyp2c69 T C 19: 39,881,557 I74V probably benign Het
Dennd4c T A 4: 86,799,353 V529D probably damaging Het
Dlgap3 C A 4: 127,194,625 H5N possibly damaging Het
Dusp10 C A 1: 184,037,420 H194Q probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eln C G 5: 134,707,575 G753A unknown Het
Emb T A 13: 117,249,426 N118K possibly damaging Het
Fam184a C T 10: 53,655,014 V755I probably benign Het
Fryl A G 5: 73,097,561 I846T possibly damaging Het
Gabbr2 T A 4: 46,681,166 I722F probably damaging Het
Gabrb3 T A 7: 57,824,423 D362E possibly damaging Het
Galnt2 G A 8: 124,334,338 G357D probably damaging Het
Gbx2 A T 1: 89,930,651 S35R probably benign Het
Glg1 A G 8: 111,197,735 I207T possibly damaging Het
Gm10192 A T 4: 97,183,035 N44K unknown Het
Gpd1 A G 15: 99,720,103 D123G probably benign Het
Grm2 A T 9: 106,653,851 D146E possibly damaging Het
Gsg1l2 A G 11: 67,785,206 D132G probably benign Het
Hecw1 C T 13: 14,340,840 G236R probably damaging Het
Hif3a G A 7: 17,042,635 T462I possibly damaging Het
Hspg2 C T 4: 137,539,403 A1934V probably benign Het
Il7r C T 15: 9,513,031 A131T probably damaging Het
Itga6 C T 2: 71,838,336 R540* probably null Het
Kcnh2 A G 5: 24,325,492 probably null Het
Kcnq4 C T 4: 120,715,825 A260T probably damaging Het
Lrp1b T C 2: 40,801,505 N3434S Het
Lrrc41 C T 4: 116,089,041 P318S probably damaging Het
Map4 G A 9: 110,068,824 G873R possibly damaging Het
Med24 A G 11: 98,704,961 I968T possibly damaging Het
Mfap5 T C 6: 122,526,862 probably null Het
Mtcl1 A G 17: 66,379,490 V807A probably benign Het
Mug1 T A 6: 121,878,508 S934T possibly damaging Het
Nckap5l C A 15: 99,423,246 V1218F probably damaging Het
Nek1 T A 8: 61,130,145 D1272E probably benign Het
Nkx2-4 T C 2: 147,084,168 E258G probably benign Het
Polr1a T A 6: 71,936,297 V545E probably damaging Het
Ppp1r9b A G 11: 94,992,032 D162G possibly damaging Het
Rhot2 A G 17: 25,840,749 L367P probably damaging Het
Ripk2 A G 4: 16,155,154 F122L probably benign Het
Scn11a T C 9: 119,759,875 T1322A probably benign Het
Scn8a T A 15: 100,955,477 L115Q probably damaging Het
Sel1l3 G T 5: 53,117,120 P1006Q probably damaging Het
Sept11 A T 5: 93,156,945 N207I probably damaging Het
Sez6l2 C T 7: 126,963,659 T669I probably damaging Het
Sfxn4 T A 19: 60,858,674 D57V possibly damaging Het
Smarca2 T A 19: 26,640,487 V306D probably benign Het
Srgap3 C T 6: 112,735,833 probably null Het
Tas2r134 T C 2: 51,627,529 F7L not run Het
Tbcd T C 11: 121,492,605 probably null Het
Tcn2 G A 11: 3,917,703 A413V probably damaging Het
Tdp1 T C 12: 99,891,395 V71A probably benign Het
Tjp1 T C 7: 65,301,180 T1649A probably damaging Het
Tnc T C 4: 64,017,628 E357G possibly damaging Het
Tnrc6b A G 15: 80,889,126 T1158A probably benign Het
Ttn C A 2: 76,738,608 E27314* probably null Het
Vps35 G T 8: 85,270,805 T512K probably benign Het
Zfp40 A T 17: 23,177,318 S98R probably benign Het
Zfp976 T A 7: 42,613,179 E412D probably benign Het
Other mutations in Zfp945
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Zfp945 APN 17 22851957 unclassified probably benign
IGL01077:Zfp945 APN 17 22852385 missense probably damaging 0.99
IGL02706:Zfp945 APN 17 22857282 missense probably damaging 1.00
IGL03408:Zfp945 APN 17 22852537 nonsense probably null
small-scale UTSW 17 22850981 missense probably damaging 1.00
R0427:Zfp945 UTSW 17 22865252 missense probably benign 0.10
R0718:Zfp945 UTSW 17 22851030 missense probably damaging 1.00
R1305:Zfp945 UTSW 17 22852386 missense probably damaging 0.97
R1801:Zfp945 UTSW 17 22851762 missense probably damaging 0.97
R1837:Zfp945 UTSW 17 22851273 missense probably damaging 1.00
R2001:Zfp945 UTSW 17 22857249 critical splice donor site probably null
R4193:Zfp945 UTSW 17 22851170 unclassified probably benign
R4247:Zfp945 UTSW 17 22850609 missense probably damaging 0.98
R5026:Zfp945 UTSW 17 22850885 missense probably damaging 1.00
R5918:Zfp945 UTSW 17 22850981 missense probably damaging 1.00
R6076:Zfp945 UTSW 17 22851458 missense probably damaging 1.00
R6664:Zfp945 UTSW 17 22852365 missense probably damaging 0.99
R6997:Zfp945 UTSW 17 22852569 nonsense probably null
R7040:Zfp945 UTSW 17 22852290 missense probably damaging 0.98
R7566:Zfp945 UTSW 17 22851753 missense possibly damaging 0.71
R7948:Zfp945 UTSW 17 22852122 missense unknown
R8383:Zfp945 UTSW 17 22851824 missense probably benign 0.05
X0063:Zfp945 UTSW 17 22852228 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GATTTGTCACATTCCCTGCATT -3'
(R):5'- CTGTGACAAATCCTTCCACCGG -3'

Sequencing Primer
(F):5'- CCGGTTAAAGGATTTGTCACATCCAC -3'
(R):5'- GGAAAGACCACCTTAGAATTCATCAG -3'
Posted On2019-10-07